Mutagenetix > Incidental Mutations

Incidental Mutation 'R2087:Ctps'

231508

Institutional Source

Beutler Lab

Gene Symbol

Ctps

Ensembl Gene

ENSMUSG00000028633

Gene Name

cytidine 5'-triphosphate synthase

Synonyms

MMRRC Submission

040092-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R2087 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120539868-120570276 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120562815 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 134 (D134G)

Ref Sequence

ENSEMBL: ENSMUSP00000030381 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030381]

Predicted Effect

probably benign
Transcript: ENSMUST00000030381
AA Change: D134G

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633
AA Change: D134G

Domain	Start	End	E-Value	Type
Pfam:CTP_synth_N	2	277	2.8e-135	PFAM
Pfam:GATase	309	546	6.7e-55	PFAM
Pfam:Peptidase_C26	378	528	3.8e-10	PFAM
low complexity region	565	578	N/A	INTRINSIC

Meta Mutation Damage Score

0.3283

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021P04Rik	T	A	19: 24,065,000		noncoding transcript	Het
Adamts8	G	A	9: 30,962,112	R871Q	probably damaging	Het
Ank1	T	C	8: 23,093,811	L310S	probably damaging	Het
Atp2a3	A	G	11: 72,980,448	T592A	probably damaging	Het
Bpifb6	A	G	2: 153,906,078	D219G	possibly damaging	Het
Catsper4	T	C	4: 134,226,605	N81S	probably damaging	Het
Ccdc14	T	C	16: 34,695,645		probably null	Het
Ces1c	A	C	8: 93,107,602	N353K	probably benign	Het
Chrna6	T	A	8: 27,407,127	M241L	probably benign	Het
Chtf8	T	A	8: 106,885,936	R124*	probably null	Het
Cpt1b	A	G	15: 89,422,208	V296A	probably benign	Het
Cryl1	G	A	14: 57,275,945	S273L	possibly damaging	Het
Cyp4f18	T	C	8: 72,000,988	M138V	probably benign	Het
Dnajb12	A	G	10: 59,890,845	K107R	possibly damaging	Het
Epha1	C	T	6: 42,363,568	D590N	probably benign	Het
Fndc3b	A	G	3: 27,451,554	V855A	probably benign	Het
Ganc	A	G	2: 120,457,257	Y822C	probably damaging	Het
Hook2	A	G	8: 85,002,691	D622G	probably damaging	Het
Kcnj8	T	A	6: 142,565,696	N395I	probably benign	Het
Kdm4b	T	C	17: 56,389,564	S427P	possibly damaging	Het
Krt12	A	G	11: 99,418,633	F267S	probably damaging	Het
Lrrn2	T	G	1: 132,937,751	F185V	probably damaging	Het
Mecom	A	G	3: 29,952,814	S764P	probably benign	Het
Mfsd14b	C	G	13: 65,067,982	G386R	probably damaging	Het
Mrm2	A	G	5: 140,328,400	S227P	probably damaging	Het
Mug1	A	G	6: 121,856,291	N285S	probably benign	Het
Nalcn	T	C	14: 123,281,145	T1661A	probably benign	Het
Ncoa6	G	A	2: 155,406,159	R1742*	probably null	Het
Nln	T	A	13: 104,037,369	H548L	probably damaging	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Olfr457	A	T	6: 42,472,051	N42K	probably damaging	Het
Olfr688	T	A	7: 105,288,186	I31N	probably benign	Het
Pgm5	T	C	19: 24,733,563	Y425C	probably damaging	Het
Pld2	A	G	11: 70,542,960	D242G	probably damaging	Het
Plekhm1	A	G	11: 103,397,025		probably null	Het
Ptdss1	T	C	13: 66,976,817		probably benign	Het
Pyroxd2	G	T	19: 42,733,770	L415I	probably benign	Het
Rapgef6	A	G	11: 54,631,249	T291A	probably damaging	Het
Rb1	A	G	14: 73,280,252	I238T	probably benign	Het
Rp1	G	A	1: 4,348,352	H846Y	probably damaging	Het
Rpgrip1	T	A	14: 52,136,622		probably null	Het
Scaf4	T	C	16: 90,252,425	D258G	unknown	Het
Ska1	A	T	18: 74,206,849	C9S	probably benign	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc43a1	G	A	2: 84,849,831	R107Q	probably damaging	Het
Slc44a3	T	A	3: 121,525,670	N141Y	probably damaging	Het
Slit1	A	T	19: 41,637,483	D613E	probably benign	Het
Spata22	A	T	11: 73,340,253	Y111F	probably benign	Het
Tchh	C	A	3: 93,443,918	R222S	unknown	Het
Tekt3	A	G	11: 63,094,697	D443G	possibly damaging	Het
Tns2	A	T	15: 102,107,119	Q144L	possibly damaging	Het
Troap	T	C	15: 99,078,817	V274A	possibly damaging	Het
Ugt1a8	A	G	1: 88,088,273	Y136C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,499	M604L	probably benign	Het
Vps13b	T	A	15: 35,597,493	W1060R	probably damaging	Het
Wdfy3	A	G	5: 101,895,060	S1942P	probably damaging	Het
Wdr90	G	A	17: 25,846,603	T1596I	probably damaging	Het
Zc3h4	A	G	7: 16,416,940	E69G	possibly damaging	Het

Other mutations in Ctps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Ctps	APN	4	120552944	missense	probably damaging	1.00
IGL00919:Ctps	APN	4	120567348	missense	probably benign	0.03
IGL01510:Ctps	APN	4	120558844	missense	probably damaging	0.98
IGL01686:Ctps	APN	4	120553986	missense	probably benign
IGL01897:Ctps	APN	4	120567279	missense	probably damaging	1.00
IGL02261:Ctps	APN	4	120542579	missense	possibly damaging	0.53
IGL02797:Ctps	APN	4	120562824	missense	probably benign	0.03
R0125:Ctps	UTSW	4	120561525	splice site	probably benign
R1053:Ctps	UTSW	4	120543722	splice site	probably null
R3736:Ctps	UTSW	4	120543746	missense	probably benign
R3928:Ctps	UTSW	4	120541896	missense	probably benign
R3929:Ctps	UTSW	4	120541896	missense	probably benign
R4193:Ctps	UTSW	4	120548138	missense	probably damaging	1.00
R4389:Ctps	UTSW	4	120558790	missense	probably damaging	1.00
R4853:Ctps	UTSW	4	120554010	missense	probably damaging	1.00
R5045:Ctps	UTSW	4	120552878	critical splice donor site	probably null
R5074:Ctps	UTSW	4	120553973	missense	probably damaging	1.00
R5566:Ctps	UTSW	4	120554103	splice site	probably null
R6235:Ctps	UTSW	4	120558806	missense	probably benign	0.42
R6828:Ctps	UTSW	4	120548138	missense	probably damaging	1.00
R7232:Ctps	UTSW	4	120548124	missense	probably damaging	1.00
R7487:Ctps	UTSW	4	120558800	missense	probably damaging	1.00
X0027:Ctps	UTSW	4	120554093	missense	probably damaging	1.00
X0062:Ctps	UTSW	4	120542617	missense	probably benign
Z1176:Ctps	UTSW	4	120542743	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTACTGGTGGTTAAGGAGAGG -3'
(R):5'- CTAGGGAAGTGTGAGCCCAAAC -3'

Sequencing Primer
(F):5'- GGTGGCTCACAATCATCCATAATG -3'
(R):5'- GTGTGAGCCCAAACATTTATTGAGTC -3'

Posted On

2014-09-18