Incidental Mutation 'R2087:Vmn2r23'
ID 231517
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission 040092-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R2087 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123718458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 604 (M604L)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158091
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: M604L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: M604L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021P04Rik T A 19: 24,042,364 (GRCm39) noncoding transcript Het
Adamts8 G A 9: 30,873,408 (GRCm39) R871Q probably damaging Het
Ank1 T C 8: 23,583,827 (GRCm39) L310S probably damaging Het
Atp2a3 A G 11: 72,871,274 (GRCm39) T592A probably damaging Het
Bpifb6 A G 2: 153,747,998 (GRCm39) D219G possibly damaging Het
Catsper4 T C 4: 133,953,916 (GRCm39) N81S probably damaging Het
Ccdc14 T C 16: 34,516,015 (GRCm39) probably null Het
Ces1c A C 8: 93,834,230 (GRCm39) N353K probably benign Het
Chrna6 T A 8: 27,897,155 (GRCm39) M241L probably benign Het
Chtf8 T A 8: 107,612,568 (GRCm39) R124* probably null Het
Cpt1b A G 15: 89,306,411 (GRCm39) V296A probably benign Het
Cryl1 G A 14: 57,513,402 (GRCm39) S273L possibly damaging Het
Ctps1 T C 4: 120,420,012 (GRCm39) D134G probably benign Het
Cyp4f18 T C 8: 72,754,832 (GRCm39) M138V probably benign Het
Dnajb12 A G 10: 59,726,667 (GRCm39) K107R possibly damaging Het
Epha1 C T 6: 42,340,502 (GRCm39) D590N probably benign Het
Fndc3b A G 3: 27,505,703 (GRCm39) V855A probably benign Het
Ganc A G 2: 120,287,738 (GRCm39) Y822C probably damaging Het
Hook2 A G 8: 85,729,320 (GRCm39) D622G probably damaging Het
Kcnj8 T A 6: 142,511,422 (GRCm39) N395I probably benign Het
Kdm4b T C 17: 56,696,564 (GRCm39) S427P possibly damaging Het
Krt12 A G 11: 99,309,459 (GRCm39) F267S probably damaging Het
Lrrn2 T G 1: 132,865,489 (GRCm39) F185V probably damaging Het
Mecom A G 3: 30,006,963 (GRCm39) S764P probably benign Het
Mfsd14b C G 13: 65,215,796 (GRCm39) G386R probably damaging Het
Mrm2 A G 5: 140,314,155 (GRCm39) S227P probably damaging Het
Mug1 A G 6: 121,833,250 (GRCm39) N285S probably benign Het
Nalcn T C 14: 123,518,557 (GRCm39) T1661A probably benign Het
Ncoa6 G A 2: 155,248,079 (GRCm39) R1742* probably null Het
Nln T A 13: 104,173,877 (GRCm39) H548L probably damaging Het
Nrros C T 16: 31,962,975 (GRCm39) W311* probably null Het
Or2r3 A T 6: 42,448,985 (GRCm39) N42K probably damaging Het
Or56b34 T A 7: 104,937,393 (GRCm39) I31N probably benign Het
Pgm5 T C 19: 24,710,927 (GRCm39) Y425C probably damaging Het
Pld2 A G 11: 70,433,786 (GRCm39) D242G probably damaging Het
Plekhm1 A G 11: 103,287,851 (GRCm39) probably null Het
Ptdss1 T C 13: 67,124,881 (GRCm39) probably benign Het
Pyroxd2 G T 19: 42,722,209 (GRCm39) L415I probably benign Het
Rapgef6 A G 11: 54,522,075 (GRCm39) T291A probably damaging Het
Rb1 A G 14: 73,517,692 (GRCm39) I238T probably benign Het
Rp1 G A 1: 4,418,575 (GRCm39) H846Y probably damaging Het
Rpgrip1 T A 14: 52,374,079 (GRCm39) probably null Het
Scaf4 T C 16: 90,049,313 (GRCm39) D258G unknown Het
Ska1 A T 18: 74,339,920 (GRCm39) C9S probably benign Het
Skp2 C A 15: 9,113,786 (GRCm39) G376C probably damaging Het
Slc43a1 G A 2: 84,680,175 (GRCm39) R107Q probably damaging Het
Slc44a3 T A 3: 121,319,319 (GRCm39) N141Y probably damaging Het
Slit1 A T 19: 41,625,922 (GRCm39) D613E probably benign Het
Spata22 A T 11: 73,231,079 (GRCm39) Y111F probably benign Het
Tchh C A 3: 93,351,225 (GRCm39) R222S unknown Het
Tekt3 A G 11: 62,985,523 (GRCm39) D443G possibly damaging Het
Tns2 A T 15: 102,015,554 (GRCm39) Q144L possibly damaging Het
Troap T C 15: 98,976,698 (GRCm39) V274A possibly damaging Het
Ugt1a8 A G 1: 88,015,995 (GRCm39) Y136C probably damaging Het
Vps13b T A 15: 35,597,639 (GRCm39) W1060R probably damaging Het
Wdfy3 A G 5: 102,042,926 (GRCm39) S1942P probably damaging Het
Wdr90 G A 17: 26,065,577 (GRCm39) T1596I probably damaging Het
Zc3h4 A G 7: 16,150,865 (GRCm39) E69G possibly damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123,690,075 (GRCm39) missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATATGTGTAGCTGGAGACTGATG -3'
(R):5'- TTGCCAAGATAGCAGAAACAGC -3'

Sequencing Primer
(F):5'- GGTGGAATATAATAAACCAATCTGCC -3'
(R):5'- CCAAGATAGCAGAAACAGCAATGG -3'
Posted On 2014-09-18