Incidental Mutation 'R2087:Hook2'
ID231524
Institutional Source Beutler Lab
Gene Symbol Hook2
Ensembl Gene ENSMUSG00000052566
Gene Namehook microtubule tethering protein 2
Synonyms
MMRRC Submission 040092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R2087 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84990603-85003349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85002691 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 622 (D622G)
Ref Sequence ENSEMBL: ENSMUSP00000148237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059072] [ENSMUST00000064495] [ENSMUST00000209322] [ENSMUST00000209421] [ENSMUST00000209764] [ENSMUST00000210326]
Predicted Effect probably benign
Transcript: ENSMUST00000059072
SMART Domains Protein: ENSMUSP00000053408
Gene: ENSMUSG00000052819

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 5.8e-118 PFAM
low complexity region 340 352 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 428 447 N/A INTRINSIC
low complexity region 457 479 N/A INTRINSIC
low complexity region 484 501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064495
AA Change: D646G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067752
Gene: ENSMUSG00000052566
AA Change: D646G

DomainStartEndE-ValueType
Pfam:HOOK 8 703 2.3e-277 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209322
Predicted Effect probably benign
Transcript: ENSMUST00000209421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209652
Predicted Effect probably damaging
Transcript: ENSMUST00000209764
AA Change: D622G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000210326
Meta Mutation Damage Score 0.4340 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021P04Rik T A 19: 24,065,000 noncoding transcript Het
Adamts8 G A 9: 30,962,112 R871Q probably damaging Het
Ank1 T C 8: 23,093,811 L310S probably damaging Het
Atp2a3 A G 11: 72,980,448 T592A probably damaging Het
Bpifb6 A G 2: 153,906,078 D219G possibly damaging Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccdc14 T C 16: 34,695,645 probably null Het
Ces1c A C 8: 93,107,602 N353K probably benign Het
Chrna6 T A 8: 27,407,127 M241L probably benign Het
Chtf8 T A 8: 106,885,936 R124* probably null Het
Cpt1b A G 15: 89,422,208 V296A probably benign Het
Cryl1 G A 14: 57,275,945 S273L possibly damaging Het
Ctps T C 4: 120,562,815 D134G probably benign Het
Cyp4f18 T C 8: 72,000,988 M138V probably benign Het
Dnajb12 A G 10: 59,890,845 K107R possibly damaging Het
Epha1 C T 6: 42,363,568 D590N probably benign Het
Fndc3b A G 3: 27,451,554 V855A probably benign Het
Ganc A G 2: 120,457,257 Y822C probably damaging Het
Kcnj8 T A 6: 142,565,696 N395I probably benign Het
Kdm4b T C 17: 56,389,564 S427P possibly damaging Het
Krt12 A G 11: 99,418,633 F267S probably damaging Het
Lrrn2 T G 1: 132,937,751 F185V probably damaging Het
Mecom A G 3: 29,952,814 S764P probably benign Het
Mfsd14b C G 13: 65,067,982 G386R probably damaging Het
Mrm2 A G 5: 140,328,400 S227P probably damaging Het
Mug1 A G 6: 121,856,291 N285S probably benign Het
Nalcn T C 14: 123,281,145 T1661A probably benign Het
Ncoa6 G A 2: 155,406,159 R1742* probably null Het
Nln T A 13: 104,037,369 H548L probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr457 A T 6: 42,472,051 N42K probably damaging Het
Olfr688 T A 7: 105,288,186 I31N probably benign Het
Pgm5 T C 19: 24,733,563 Y425C probably damaging Het
Pld2 A G 11: 70,542,960 D242G probably damaging Het
Plekhm1 A G 11: 103,397,025 probably null Het
Ptdss1 T C 13: 66,976,817 probably benign Het
Pyroxd2 G T 19: 42,733,770 L415I probably benign Het
Rapgef6 A G 11: 54,631,249 T291A probably damaging Het
Rb1 A G 14: 73,280,252 I238T probably benign Het
Rp1 G A 1: 4,348,352 H846Y probably damaging Het
Rpgrip1 T A 14: 52,136,622 probably null Het
Scaf4 T C 16: 90,252,425 D258G unknown Het
Ska1 A T 18: 74,206,849 C9S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc43a1 G A 2: 84,849,831 R107Q probably damaging Het
Slc44a3 T A 3: 121,525,670 N141Y probably damaging Het
Slit1 A T 19: 41,637,483 D613E probably benign Het
Spata22 A T 11: 73,340,253 Y111F probably benign Het
Tchh C A 3: 93,443,918 R222S unknown Het
Tekt3 A G 11: 63,094,697 D443G possibly damaging Het
Tns2 A T 15: 102,107,119 Q144L possibly damaging Het
Troap T C 15: 99,078,817 V274A possibly damaging Het
Ugt1a8 A G 1: 88,088,273 Y136C probably damaging Het
Vmn2r23 A T 6: 123,741,499 M604L probably benign Het
Vps13b T A 15: 35,597,493 W1060R probably damaging Het
Wdfy3 A G 5: 101,895,060 S1942P probably damaging Het
Wdr90 G A 17: 25,846,603 T1596I probably damaging Het
Zc3h4 A G 7: 16,416,940 E69G possibly damaging Het
Other mutations in Hook2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hook2 APN 8 85002497 unclassified probably benign
IGL01161:Hook2 APN 8 84994931 missense probably benign 0.05
IGL01535:Hook2 APN 8 85002989 missense probably benign 0.00
IGL01668:Hook2 APN 8 84993578 missense possibly damaging 0.88
IGL01749:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01750:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01753:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01900:Hook2 APN 8 85001311 unclassified probably benign
IGL02157:Hook2 APN 8 85001150 unclassified probably benign
IGL02175:Hook2 APN 8 84991402 missense probably damaging 1.00
IGL02350:Hook2 APN 8 84994985 nonsense probably null
IGL02357:Hook2 APN 8 84994985 nonsense probably null
IGL03377:Hook2 APN 8 85001335 nonsense probably null
R0399:Hook2 UTSW 8 84993567 splice site probably benign
R1133:Hook2 UTSW 8 84995804 missense probably damaging 1.00
R2277:Hook2 UTSW 8 85002931 nonsense probably null
R2398:Hook2 UTSW 8 84991299 missense probably damaging 0.98
R3406:Hook2 UTSW 8 84993984 splice site probably benign
R4752:Hook2 UTSW 8 85002720 nonsense probably null
R5014:Hook2 UTSW 8 84991377 missense probably damaging 1.00
R5068:Hook2 UTSW 8 84993399 missense possibly damaging 0.81
R5195:Hook2 UTSW 8 84994776 missense probably damaging 1.00
R5360:Hook2 UTSW 8 85001404 missense probably damaging 1.00
R5597:Hook2 UTSW 8 84994028 missense probably benign 0.00
R5614:Hook2 UTSW 8 85002508 missense probably damaging 1.00
R5843:Hook2 UTSW 8 84991283 missense probably damaging 0.99
R5931:Hook2 UTSW 8 84995746 nonsense probably null
R5942:Hook2 UTSW 8 84994780 splice site probably null
R6120:Hook2 UTSW 8 84998125 missense probably damaging 1.00
R6167:Hook2 UTSW 8 84995013 missense probably damaging 1.00
R6936:Hook2 UTSW 8 85002998 missense probably benign 0.04
R6992:Hook2 UTSW 8 85002556 missense probably damaging 1.00
R7058:Hook2 UTSW 8 84997411 missense possibly damaging 0.89
R7101:Hook2 UTSW 8 84997051 missense probably benign
R7177:Hook2 UTSW 8 84991417 missense probably benign 0.07
R8072:Hook2 UTSW 8 84994491 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGTTGCTCTCCTGTGCTC -3'
(R):5'- GCCATGCCCTAGAGAAATGG -3'

Sequencing Primer
(F):5'- GTCATTCAGACCCTGGAACC -3'
(R):5'- GCCCTAGAGAAATGGTATAATTAGC -3'
Posted On2014-09-18