Mutagenetix > Incidental Mutations

Incidental Mutation 'R2087:Hook2'

231524

Institutional Source

Beutler Lab

Gene Symbol

Hook2

Ensembl Gene

ENSMUSG00000052566

Gene Name

hook microtubule tethering protein 2

Synonyms

MMRRC Submission

040092-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R2087 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84990603-85003349 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85002691 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 622 (D622G)

Ref Sequence

ENSEMBL: ENSMUSP00000148237 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059072] [ENSMUST00000064495] [ENSMUST00000209322] [ENSMUST00000209421] [ENSMUST00000209764] [ENSMUST00000210326]

Predicted Effect

probably benign
Transcript: ENSMUST00000059072

SMART Domains

Protein: ENSMUSP00000053408
Gene: ENSMUSG00000052819

Domain	Start	End	E-Value	Type
Pfam:Bestrophin	8	316	5.8e-118	PFAM
low complexity region	340	352	N/A	INTRINSIC
low complexity region	408	417	N/A	INTRINSIC
low complexity region	428	447	N/A	INTRINSIC
low complexity region	457	479	N/A	INTRINSIC
low complexity region	484	501	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000064495
AA Change: D646G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000067752
Gene: ENSMUSG00000052566
AA Change: D646G

Domain	Start	End	E-Value	Type
Pfam:HOOK	8	703	2.3e-277	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209322

Predicted Effect

probably benign
Transcript: ENSMUST00000209421

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209652

Predicted Effect

probably damaging
Transcript: ENSMUST00000209764
AA Change: D622G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000210326

Meta Mutation Damage Score

0.4340

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021P04Rik	T	A	19: 24,065,000		noncoding transcript	Het
Adamts8	G	A	9: 30,962,112	R871Q	probably damaging	Het
Ank1	T	C	8: 23,093,811	L310S	probably damaging	Het
Atp2a3	A	G	11: 72,980,448	T592A	probably damaging	Het
Bpifb6	A	G	2: 153,906,078	D219G	possibly damaging	Het
Catsper4	T	C	4: 134,226,605	N81S	probably damaging	Het
Ccdc14	T	C	16: 34,695,645		probably null	Het
Ces1c	A	C	8: 93,107,602	N353K	probably benign	Het
Chrna6	T	A	8: 27,407,127	M241L	probably benign	Het
Chtf8	T	A	8: 106,885,936	R124*	probably null	Het
Cpt1b	A	G	15: 89,422,208	V296A	probably benign	Het
Cryl1	G	A	14: 57,275,945	S273L	possibly damaging	Het
Ctps	T	C	4: 120,562,815	D134G	probably benign	Het
Cyp4f18	T	C	8: 72,000,988	M138V	probably benign	Het
Dnajb12	A	G	10: 59,890,845	K107R	possibly damaging	Het
Epha1	C	T	6: 42,363,568	D590N	probably benign	Het
Fndc3b	A	G	3: 27,451,554	V855A	probably benign	Het
Ganc	A	G	2: 120,457,257	Y822C	probably damaging	Het
Kcnj8	T	A	6: 142,565,696	N395I	probably benign	Het
Kdm4b	T	C	17: 56,389,564	S427P	possibly damaging	Het
Krt12	A	G	11: 99,418,633	F267S	probably damaging	Het
Lrrn2	T	G	1: 132,937,751	F185V	probably damaging	Het
Mecom	A	G	3: 29,952,814	S764P	probably benign	Het
Mfsd14b	C	G	13: 65,067,982	G386R	probably damaging	Het
Mrm2	A	G	5: 140,328,400	S227P	probably damaging	Het
Mug1	A	G	6: 121,856,291	N285S	probably benign	Het
Nalcn	T	C	14: 123,281,145	T1661A	probably benign	Het
Ncoa6	G	A	2: 155,406,159	R1742*	probably null	Het
Nln	T	A	13: 104,037,369	H548L	probably damaging	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Olfr457	A	T	6: 42,472,051	N42K	probably damaging	Het
Olfr688	T	A	7: 105,288,186	I31N	probably benign	Het
Pgm5	T	C	19: 24,733,563	Y425C	probably damaging	Het
Pld2	A	G	11: 70,542,960	D242G	probably damaging	Het
Plekhm1	A	G	11: 103,397,025		probably null	Het
Ptdss1	T	C	13: 66,976,817		probably benign	Het
Pyroxd2	G	T	19: 42,733,770	L415I	probably benign	Het
Rapgef6	A	G	11: 54,631,249	T291A	probably damaging	Het
Rb1	A	G	14: 73,280,252	I238T	probably benign	Het
Rp1	G	A	1: 4,348,352	H846Y	probably damaging	Het
Rpgrip1	T	A	14: 52,136,622		probably null	Het
Scaf4	T	C	16: 90,252,425	D258G	unknown	Het
Ska1	A	T	18: 74,206,849	C9S	probably benign	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc43a1	G	A	2: 84,849,831	R107Q	probably damaging	Het
Slc44a3	T	A	3: 121,525,670	N141Y	probably damaging	Het
Slit1	A	T	19: 41,637,483	D613E	probably benign	Het
Spata22	A	T	11: 73,340,253	Y111F	probably benign	Het
Tchh	C	A	3: 93,443,918	R222S	unknown	Het
Tekt3	A	G	11: 63,094,697	D443G	possibly damaging	Het
Tns2	A	T	15: 102,107,119	Q144L	possibly damaging	Het
Troap	T	C	15: 99,078,817	V274A	possibly damaging	Het
Ugt1a8	A	G	1: 88,088,273	Y136C	probably damaging	Het
Vmn2r23	A	T	6: 123,741,499	M604L	probably benign	Het
Vps13b	T	A	15: 35,597,493	W1060R	probably damaging	Het
Wdfy3	A	G	5: 101,895,060	S1942P	probably damaging	Het
Wdr90	G	A	17: 25,846,603	T1596I	probably damaging	Het
Zc3h4	A	G	7: 16,416,940	E69G	possibly damaging	Het

Other mutations in Hook2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00921:Hook2	APN	8	85002497	unclassified	probably benign
IGL01161:Hook2	APN	8	84994931	missense	probably benign	0.05
IGL01535:Hook2	APN	8	85002989	missense	probably benign	0.00
IGL01668:Hook2	APN	8	84993578	missense	possibly damaging	0.88
IGL01749:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01750:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01753:Hook2	APN	8	84993236	critical splice donor site	probably null
IGL01900:Hook2	APN	8	85001311	unclassified	probably benign
IGL02157:Hook2	APN	8	85001150	unclassified	probably benign
IGL02175:Hook2	APN	8	84991402	missense	probably damaging	1.00
IGL02350:Hook2	APN	8	84994985	nonsense	probably null
IGL02357:Hook2	APN	8	84994985	nonsense	probably null
IGL03377:Hook2	APN	8	85001335	nonsense	probably null
R0399:Hook2	UTSW	8	84993567	splice site	probably benign
R1133:Hook2	UTSW	8	84995804	missense	probably damaging	1.00
R2277:Hook2	UTSW	8	85002931	nonsense	probably null
R2398:Hook2	UTSW	8	84991299	missense	probably damaging	0.98
R3406:Hook2	UTSW	8	84993984	splice site	probably benign
R4752:Hook2	UTSW	8	85002720	nonsense	probably null
R5014:Hook2	UTSW	8	84991377	missense	probably damaging	1.00
R5068:Hook2	UTSW	8	84993399	missense	possibly damaging	0.81
R5195:Hook2	UTSW	8	84994776	missense	probably damaging	1.00
R5360:Hook2	UTSW	8	85001404	missense	probably damaging	1.00
R5597:Hook2	UTSW	8	84994028	missense	probably benign	0.00
R5614:Hook2	UTSW	8	85002508	missense	probably damaging	1.00
R5843:Hook2	UTSW	8	84991283	missense	probably damaging	0.99
R5931:Hook2	UTSW	8	84995746	nonsense	probably null
R5942:Hook2	UTSW	8	84994780	splice site	probably null
R6120:Hook2	UTSW	8	84998125	missense	probably damaging	1.00
R6167:Hook2	UTSW	8	84995013	missense	probably damaging	1.00
R6936:Hook2	UTSW	8	85002998	missense	probably benign	0.04
R6992:Hook2	UTSW	8	85002556	missense	probably damaging	1.00
R7058:Hook2	UTSW	8	84997411	missense	possibly damaging	0.89
R7101:Hook2	UTSW	8	84997051	missense	probably benign
R7177:Hook2	UTSW	8	84991417	missense	probably benign	0.07
R8072:Hook2	UTSW	8	84994491	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AAGGTTGCTCTCCTGTGCTC -3'
(R):5'- GCCATGCCCTAGAGAAATGG -3'

Sequencing Primer
(F):5'- GTCATTCAGACCCTGGAACC -3'
(R):5'- GCCCTAGAGAAATGGTATAATTAGC -3'

Posted On

2014-09-18