Incidental Mutation 'R2087:Adamts8'
ID231527
Institutional Source Beutler Lab
Gene Symbol Adamts8
Ensembl Gene ENSMUSG00000031994
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
SynonymsMETH-2, METH2
MMRRC Submission 040092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2087 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location30942562-30963838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30962112 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 871 (R871Q)
Ref Sequence ENSEMBL: ENSMUSP00000069644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]
Predicted Effect probably damaging
Transcript: ENSMUST00000068135
AA Change: R871Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: R871Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 152 6.4e-23 PFAM
Pfam:Reprolysin_5 232 418 1.3e-15 PFAM
Pfam:Reprolysin_4 233 435 3.4e-8 PFAM
Pfam:Reprolysin 234 444 3.8e-21 PFAM
Pfam:Reprolysin_2 252 434 1.3e-10 PFAM
Pfam:Reprolysin_3 255 389 7.4e-14 PFAM
TSP1 545 597 7.04e-14 SMART
Pfam:ADAM_spacer1 706 825 3.2e-35 PFAM
TSP1 851 904 5.35e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163037
SMART Domains Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994

DomainStartEndE-ValueType
PDB:2V4B|B 22 128 2e-38 PDB
SCOP:d1kufa_ 27 128 2e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214688
Meta Mutation Damage Score 0.4043 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021P04Rik T A 19: 24,065,000 noncoding transcript Het
Ank1 T C 8: 23,093,811 L310S probably damaging Het
Atp2a3 A G 11: 72,980,448 T592A probably damaging Het
Bpifb6 A G 2: 153,906,078 D219G possibly damaging Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccdc14 T C 16: 34,695,645 probably null Het
Ces1c A C 8: 93,107,602 N353K probably benign Het
Chrna6 T A 8: 27,407,127 M241L probably benign Het
Chtf8 T A 8: 106,885,936 R124* probably null Het
Cpt1b A G 15: 89,422,208 V296A probably benign Het
Cryl1 G A 14: 57,275,945 S273L possibly damaging Het
Ctps T C 4: 120,562,815 D134G probably benign Het
Cyp4f18 T C 8: 72,000,988 M138V probably benign Het
Dnajb12 A G 10: 59,890,845 K107R possibly damaging Het
Epha1 C T 6: 42,363,568 D590N probably benign Het
Fndc3b A G 3: 27,451,554 V855A probably benign Het
Ganc A G 2: 120,457,257 Y822C probably damaging Het
Hook2 A G 8: 85,002,691 D622G probably damaging Het
Kcnj8 T A 6: 142,565,696 N395I probably benign Het
Kdm4b T C 17: 56,389,564 S427P possibly damaging Het
Krt12 A G 11: 99,418,633 F267S probably damaging Het
Lrrn2 T G 1: 132,937,751 F185V probably damaging Het
Mecom A G 3: 29,952,814 S764P probably benign Het
Mfsd14b C G 13: 65,067,982 G386R probably damaging Het
Mrm2 A G 5: 140,328,400 S227P probably damaging Het
Mug1 A G 6: 121,856,291 N285S probably benign Het
Nalcn T C 14: 123,281,145 T1661A probably benign Het
Ncoa6 G A 2: 155,406,159 R1742* probably null Het
Nln T A 13: 104,037,369 H548L probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr457 A T 6: 42,472,051 N42K probably damaging Het
Olfr688 T A 7: 105,288,186 I31N probably benign Het
Pgm5 T C 19: 24,733,563 Y425C probably damaging Het
Pld2 A G 11: 70,542,960 D242G probably damaging Het
Plekhm1 A G 11: 103,397,025 probably null Het
Ptdss1 T C 13: 66,976,817 probably benign Het
Pyroxd2 G T 19: 42,733,770 L415I probably benign Het
Rapgef6 A G 11: 54,631,249 T291A probably damaging Het
Rb1 A G 14: 73,280,252 I238T probably benign Het
Rp1 G A 1: 4,348,352 H846Y probably damaging Het
Rpgrip1 T A 14: 52,136,622 probably null Het
Scaf4 T C 16: 90,252,425 D258G unknown Het
Ska1 A T 18: 74,206,849 C9S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc43a1 G A 2: 84,849,831 R107Q probably damaging Het
Slc44a3 T A 3: 121,525,670 N141Y probably damaging Het
Slit1 A T 19: 41,637,483 D613E probably benign Het
Spata22 A T 11: 73,340,253 Y111F probably benign Het
Tchh C A 3: 93,443,918 R222S unknown Het
Tekt3 A G 11: 63,094,697 D443G possibly damaging Het
Tns2 A T 15: 102,107,119 Q144L possibly damaging Het
Troap T C 15: 99,078,817 V274A possibly damaging Het
Ugt1a8 A G 1: 88,088,273 Y136C probably damaging Het
Vmn2r23 A T 6: 123,741,499 M604L probably benign Het
Vps13b T A 15: 35,597,493 W1060R probably damaging Het
Wdfy3 A G 5: 101,895,060 S1942P probably damaging Het
Wdr90 G A 17: 25,846,603 T1596I probably damaging Het
Zc3h4 A G 7: 16,416,940 E69G possibly damaging Het
Other mutations in Adamts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Adamts8 APN 9 30953500 missense probably damaging 1.00
IGL02049:Adamts8 APN 9 30951354 missense probably damaging 0.96
IGL02304:Adamts8 APN 9 30956656 missense possibly damaging 0.55
IGL02385:Adamts8 APN 9 30961730 missense probably benign 0.10
IGL02536:Adamts8 APN 9 30962072 missense probably benign 0.05
IGL03347:Adamts8 APN 9 30959238 missense possibly damaging 0.75
R0633:Adamts8 UTSW 9 30943511 missense probably damaging 1.00
R1066:Adamts8 UTSW 9 30956541 missense probably damaging 1.00
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1560:Adamts8 UTSW 9 30956667 missense probably damaging 1.00
R1592:Adamts8 UTSW 9 30943176 missense probably damaging 0.99
R1753:Adamts8 UTSW 9 30954614 missense probably benign 0.04
R1932:Adamts8 UTSW 9 30956512 missense probably benign
R2118:Adamts8 UTSW 9 30943063 missense probably damaging 1.00
R3789:Adamts8 UTSW 9 30959292 missense probably damaging 1.00
R4165:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4166:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4193:Adamts8 UTSW 9 30959308 missense probably damaging 1.00
R4425:Adamts8 UTSW 9 30956656 missense possibly damaging 0.55
R5155:Adamts8 UTSW 9 30954548 missense probably benign 0.33
R5433:Adamts8 UTSW 9 30961716 missense probably benign 0.01
R5544:Adamts8 UTSW 9 30952703 missense probably damaging 1.00
R5590:Adamts8 UTSW 9 30951336 missense probably damaging 0.97
R5640:Adamts8 UTSW 9 30956500 missense probably benign 0.00
R5800:Adamts8 UTSW 9 30954482 missense probably damaging 1.00
R5909:Adamts8 UTSW 9 30961928 missense probably benign 0.00
R6821:Adamts8 UTSW 9 30956626 missense probably benign 0.08
R6967:Adamts8 UTSW 9 30954491 missense probably benign 0.04
R7336:Adamts8 UTSW 9 30962067 missense probably benign 0.00
R7538:Adamts8 UTSW 9 30953470 missense probably damaging 1.00
R7540:Adamts8 UTSW 9 30959064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCTCTTACAGTACAGCTCC -3'
(R):5'- ATGTAGTATCACCTTGGAGGGG -3'

Sequencing Primer
(F):5'- ACAGTACAGCTCCTGACTGTG -3'
(R):5'- GGACCTTTGTCTGTTACACCAGTAG -3'
Posted On2014-09-18