Incidental Mutation 'R2087:Mfsd14b'
ID231538
Institutional Source Beutler Lab
Gene Symbol Mfsd14b
Ensembl Gene ENSMUSG00000038212
Gene Namemajor facilitator superfamily domain containing 14B
Synonyms5730414C17Rik, Hiatl1
MMRRC Submission 040092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2087 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location65064663-65112975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 65067982 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 386 (G386R)
Ref Sequence ENSEMBL: ENSMUSP00000118180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054730] [ENSMUST00000155487]
Predicted Effect probably damaging
Transcript: ENSMUST00000054730
AA Change: G386R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062566
Gene: ENSMUSG00000038212
AA Change: G386R

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.5e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148779
Predicted Effect probably damaging
Transcript: ENSMUST00000155487
AA Change: G386R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118180
Gene: ENSMUSG00000038212
AA Change: G386R

DomainStartEndE-ValueType
Pfam:MFS_1 50 396 4.6e-33 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Meta Mutation Damage Score 0.8695 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021P04Rik T A 19: 24,065,000 noncoding transcript Het
Adamts8 G A 9: 30,962,112 R871Q probably damaging Het
Ank1 T C 8: 23,093,811 L310S probably damaging Het
Atp2a3 A G 11: 72,980,448 T592A probably damaging Het
Bpifb6 A G 2: 153,906,078 D219G possibly damaging Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccdc14 T C 16: 34,695,645 probably null Het
Ces1c A C 8: 93,107,602 N353K probably benign Het
Chrna6 T A 8: 27,407,127 M241L probably benign Het
Chtf8 T A 8: 106,885,936 R124* probably null Het
Cpt1b A G 15: 89,422,208 V296A probably benign Het
Cryl1 G A 14: 57,275,945 S273L possibly damaging Het
Ctps T C 4: 120,562,815 D134G probably benign Het
Cyp4f18 T C 8: 72,000,988 M138V probably benign Het
Dnajb12 A G 10: 59,890,845 K107R possibly damaging Het
Epha1 C T 6: 42,363,568 D590N probably benign Het
Fndc3b A G 3: 27,451,554 V855A probably benign Het
Ganc A G 2: 120,457,257 Y822C probably damaging Het
Hook2 A G 8: 85,002,691 D622G probably damaging Het
Kcnj8 T A 6: 142,565,696 N395I probably benign Het
Kdm4b T C 17: 56,389,564 S427P possibly damaging Het
Krt12 A G 11: 99,418,633 F267S probably damaging Het
Lrrn2 T G 1: 132,937,751 F185V probably damaging Het
Mecom A G 3: 29,952,814 S764P probably benign Het
Mrm2 A G 5: 140,328,400 S227P probably damaging Het
Mug1 A G 6: 121,856,291 N285S probably benign Het
Nalcn T C 14: 123,281,145 T1661A probably benign Het
Ncoa6 G A 2: 155,406,159 R1742* probably null Het
Nln T A 13: 104,037,369 H548L probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr457 A T 6: 42,472,051 N42K probably damaging Het
Olfr688 T A 7: 105,288,186 I31N probably benign Het
Pgm5 T C 19: 24,733,563 Y425C probably damaging Het
Pld2 A G 11: 70,542,960 D242G probably damaging Het
Plekhm1 A G 11: 103,397,025 probably null Het
Ptdss1 T C 13: 66,976,817 probably benign Het
Pyroxd2 G T 19: 42,733,770 L415I probably benign Het
Rapgef6 A G 11: 54,631,249 T291A probably damaging Het
Rb1 A G 14: 73,280,252 I238T probably benign Het
Rp1 G A 1: 4,348,352 H846Y probably damaging Het
Rpgrip1 T A 14: 52,136,622 probably null Het
Scaf4 T C 16: 90,252,425 D258G unknown Het
Ska1 A T 18: 74,206,849 C9S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc43a1 G A 2: 84,849,831 R107Q probably damaging Het
Slc44a3 T A 3: 121,525,670 N141Y probably damaging Het
Slit1 A T 19: 41,637,483 D613E probably benign Het
Spata22 A T 11: 73,340,253 Y111F probably benign Het
Tchh C A 3: 93,443,918 R222S unknown Het
Tekt3 A G 11: 63,094,697 D443G possibly damaging Het
Tns2 A T 15: 102,107,119 Q144L possibly damaging Het
Troap T C 15: 99,078,817 V274A possibly damaging Het
Ugt1a8 A G 1: 88,088,273 Y136C probably damaging Het
Vmn2r23 A T 6: 123,741,499 M604L probably benign Het
Vps13b T A 15: 35,597,493 W1060R probably damaging Het
Wdfy3 A G 5: 101,895,060 S1942P probably damaging Het
Wdr90 G A 17: 25,846,603 T1596I probably damaging Het
Zc3h4 A G 7: 16,416,940 E69G possibly damaging Het
Other mutations in Mfsd14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Mfsd14b APN 13 65066701 missense probably benign 0.00
IGL01935:Mfsd14b APN 13 65067925 missense probably benign
IGL01957:Mfsd14b APN 13 65087093 missense possibly damaging 0.90
R0555:Mfsd14b UTSW 13 65078445 missense probably benign 0.34
R0601:Mfsd14b UTSW 13 65087150 missense possibly damaging 0.88
R0988:Mfsd14b UTSW 13 65112493 splice site probably benign
R1136:Mfsd14b UTSW 13 65095692 missense probably benign 0.22
R1494:Mfsd14b UTSW 13 65095671 missense probably damaging 1.00
R4223:Mfsd14b UTSW 13 65066608 utr 3 prime probably benign
R5103:Mfsd14b UTSW 13 65087093 missense possibly damaging 0.56
R5568:Mfsd14b UTSW 13 65072122 splice site probably null
R5603:Mfsd14b UTSW 13 65073606 missense probably benign 0.00
R6181:Mfsd14b UTSW 13 65112584 missense probably benign 0.00
R6330:Mfsd14b UTSW 13 65095686 missense probably damaging 1.00
R6649:Mfsd14b UTSW 13 65066785 missense probably damaging 1.00
R7460:Mfsd14b UTSW 13 65072023 missense probably damaging 1.00
R7605:Mfsd14b UTSW 13 65066777 missense probably benign
X0017:Mfsd14b UTSW 13 65072053 missense probably benign 0.08
X0027:Mfsd14b UTSW 13 65072011 missense probably benign 0.16
X0063:Mfsd14b UTSW 13 65078485 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCCAAGTAATGAACACAGACTTTG -3'
(R):5'- GAAACCTAATGACTGTAATAGGTGC -3'

Sequencing Primer
(F):5'- AATGAACACAGACTTTGCTACTATC -3'
(R):5'- GGTGCTATAAGATAATTAGCCTAAGC -3'
Posted On2014-09-18