Incidental Mutation 'R2087:Kdm4b'
ID231553
Institutional Source Beutler Lab
Gene Symbol Kdm4b
Ensembl Gene ENSMUSG00000024201
Gene Namelysine (K)-specific demethylase 4B
SynonymsJmjd2b, 4732474L06Rik
MMRRC Submission 040092-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2087 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56326062-56402870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56389564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 427 (S427P)
Ref Sequence ENSEMBL: ENSMUSP00000025036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025036] [ENSMUST00000086835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025036
AA Change: S427P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025036
Gene: ENSMUSG00000024201
AA Change: S427P

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 719 777 2.5e-5 SMART
PHD 839 895 7.07e-5 SMART
TUDOR 905 962 1.68e-9 SMART
TUDOR 963 1019 7.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086835
AA Change: S427P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084045
Gene: ENSMUSG00000024201
AA Change: S427P

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 712 770 2.5e-5 SMART
PHD 832 888 7.07e-5 SMART
TUDOR 898 954 2.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132363
Predicted Effect probably benign
Transcript: ENSMUST00000141507
SMART Domains Protein: ENSMUSP00000116789
Gene: ENSMUSG00000024201

DomainStartEndE-ValueType
PHD 177 235 2.5e-5 SMART
PHD 297 353 7.07e-5 SMART
TUDOR 363 420 1.68e-9 SMART
TUDOR 421 477 7.94e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147489
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele lacking demethylase activity exhibit no gross abnormalities. Mice homozygous for a conditional allele activated in mammary gland epithelial cells exhibit delayed mammary gland development with reduced branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021P04Rik T A 19: 24,065,000 noncoding transcript Het
Adamts8 G A 9: 30,962,112 R871Q probably damaging Het
Ank1 T C 8: 23,093,811 L310S probably damaging Het
Atp2a3 A G 11: 72,980,448 T592A probably damaging Het
Bpifb6 A G 2: 153,906,078 D219G possibly damaging Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccdc14 T C 16: 34,695,645 probably null Het
Ces1c A C 8: 93,107,602 N353K probably benign Het
Chrna6 T A 8: 27,407,127 M241L probably benign Het
Chtf8 T A 8: 106,885,936 R124* probably null Het
Cpt1b A G 15: 89,422,208 V296A probably benign Het
Cryl1 G A 14: 57,275,945 S273L possibly damaging Het
Ctps T C 4: 120,562,815 D134G probably benign Het
Cyp4f18 T C 8: 72,000,988 M138V probably benign Het
Dnajb12 A G 10: 59,890,845 K107R possibly damaging Het
Epha1 C T 6: 42,363,568 D590N probably benign Het
Fndc3b A G 3: 27,451,554 V855A probably benign Het
Ganc A G 2: 120,457,257 Y822C probably damaging Het
Hook2 A G 8: 85,002,691 D622G probably damaging Het
Kcnj8 T A 6: 142,565,696 N395I probably benign Het
Krt12 A G 11: 99,418,633 F267S probably damaging Het
Lrrn2 T G 1: 132,937,751 F185V probably damaging Het
Mecom A G 3: 29,952,814 S764P probably benign Het
Mfsd14b C G 13: 65,067,982 G386R probably damaging Het
Mrm2 A G 5: 140,328,400 S227P probably damaging Het
Mug1 A G 6: 121,856,291 N285S probably benign Het
Nalcn T C 14: 123,281,145 T1661A probably benign Het
Ncoa6 G A 2: 155,406,159 R1742* probably null Het
Nln T A 13: 104,037,369 H548L probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Olfr457 A T 6: 42,472,051 N42K probably damaging Het
Olfr688 T A 7: 105,288,186 I31N probably benign Het
Pgm5 T C 19: 24,733,563 Y425C probably damaging Het
Pld2 A G 11: 70,542,960 D242G probably damaging Het
Plekhm1 A G 11: 103,397,025 probably null Het
Ptdss1 T C 13: 66,976,817 probably benign Het
Pyroxd2 G T 19: 42,733,770 L415I probably benign Het
Rapgef6 A G 11: 54,631,249 T291A probably damaging Het
Rb1 A G 14: 73,280,252 I238T probably benign Het
Rp1 G A 1: 4,348,352 H846Y probably damaging Het
Rpgrip1 T A 14: 52,136,622 probably null Het
Scaf4 T C 16: 90,252,425 D258G unknown Het
Ska1 A T 18: 74,206,849 C9S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc43a1 G A 2: 84,849,831 R107Q probably damaging Het
Slc44a3 T A 3: 121,525,670 N141Y probably damaging Het
Slit1 A T 19: 41,637,483 D613E probably benign Het
Spata22 A T 11: 73,340,253 Y111F probably benign Het
Tchh C A 3: 93,443,918 R222S unknown Het
Tekt3 A G 11: 63,094,697 D443G possibly damaging Het
Tns2 A T 15: 102,107,119 Q144L possibly damaging Het
Troap T C 15: 99,078,817 V274A possibly damaging Het
Ugt1a8 A G 1: 88,088,273 Y136C probably damaging Het
Vmn2r23 A T 6: 123,741,499 M604L probably benign Het
Vps13b T A 15: 35,597,493 W1060R probably damaging Het
Wdfy3 A G 5: 101,895,060 S1942P probably damaging Het
Wdr90 G A 17: 25,846,603 T1596I probably damaging Het
Zc3h4 A G 7: 16,416,940 E69G possibly damaging Het
Other mutations in Kdm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Kdm4b APN 17 56353019 missense probably benign 0.28
IGL01408:Kdm4b APN 17 56353518 splice site probably benign
IGL01610:Kdm4b APN 17 56353522 splice site probably benign
IGL01936:Kdm4b APN 17 56397355 missense probably damaging 1.00
IGL01964:Kdm4b APN 17 56389256 splice site probably null
IGL02151:Kdm4b APN 17 56396234 missense probably benign 0.05
IGL02596:Kdm4b APN 17 56399706 missense probably benign 0.14
IGL02975:Kdm4b APN 17 56375996 splice site probably null
IGL03172:Kdm4b APN 17 56401649 missense probably damaging 0.98
Coelestinum UTSW 17 56353091 missense probably benign 0.31
mistflower UTSW 17 56389564 missense possibly damaging 0.65
R0193:Kdm4b UTSW 17 56393952 missense probably benign 0.04
R0311:Kdm4b UTSW 17 56386200 missense probably benign 0.42
R0331:Kdm4b UTSW 17 56386289 splice site probably benign
R1109:Kdm4b UTSW 17 56399430 missense probably damaging 0.99
R1499:Kdm4b UTSW 17 56400025 missense probably damaging 1.00
R1895:Kdm4b UTSW 17 56397340 missense probably damaging 1.00
R1985:Kdm4b UTSW 17 56401302 missense probably damaging 1.00
R2185:Kdm4b UTSW 17 56393750 missense probably benign 0.00
R2904:Kdm4b UTSW 17 56355884 missense probably benign 0.03
R3792:Kdm4b UTSW 17 56355944 missense probably damaging 1.00
R3897:Kdm4b UTSW 17 56396955 missense probably damaging 1.00
R4661:Kdm4b UTSW 17 56399459 missense probably damaging 1.00
R4685:Kdm4b UTSW 17 56401675 missense probably benign 0.06
R4716:Kdm4b UTSW 17 56386178 missense probably benign 0.10
R4790:Kdm4b UTSW 17 56401618 missense probably damaging 0.97
R4864:Kdm4b UTSW 17 56353091 missense probably benign 0.31
R5700:Kdm4b UTSW 17 56351700 missense possibly damaging 0.93
R5963:Kdm4b UTSW 17 56399732 missense probably damaging 1.00
R6003:Kdm4b UTSW 17 56396916 missense probably damaging 1.00
R6029:Kdm4b UTSW 17 56396576 missense probably damaging 0.98
R6769:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6771:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6927:Kdm4b UTSW 17 56399435 missense probably damaging 1.00
R7041:Kdm4b UTSW 17 56396592 missense probably damaging 0.96
R7230:Kdm4b UTSW 17 56369155 missense probably damaging 1.00
R7275:Kdm4b UTSW 17 56396333 missense probably damaging 0.99
R7454:Kdm4b UTSW 17 56389639 missense probably benign 0.00
R7455:Kdm4b UTSW 17 56396657 missense probably damaging 0.98
R7457:Kdm4b UTSW 17 56396319 missense probably damaging 1.00
X0024:Kdm4b UTSW 17 56401278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGATCTCCCTCGCATCG -3'
(R):5'- ACGGTGTAATGTGGCTAGC -3'

Sequencing Primer
(F):5'- AGCATTCTGCCCATCCTGTG -3'
(R):5'- TGTAATGTGGCTAGCAGGAGC -3'
Posted On2014-09-18