Incidental Mutation 'R0190:Crtc2'
ID23156
Institutional Source Beutler Lab
Gene Symbol Crtc2
Ensembl Gene ENSMUSG00000027936
Gene NameCREB regulated transcription coactivator 2
Synonyms
MMRRC Submission 038451-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R0190 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location90254163-90264125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90259409 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 91 (H91R)
Ref Sequence ENSEMBL: ENSMUSP00000139194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029545] [ENSMUST00000184882]
Predicted Effect probably damaging
Transcript: ENSMUST00000029545
AA Change: H176R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029545
Gene: ENSMUSG00000027936
AA Change: H176R

DomainStartEndE-ValueType
Pfam:TORC_N 18 72 1.8e-20 PFAM
low complexity region 127 141 N/A INTRINSIC
Pfam:TORC_M 168 323 3.7e-71 PFAM
low complexity region 335 384 N/A INTRINSIC
low complexity region 391 416 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 484 494 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Pfam:TORC_C 614 691 4.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149897
Predicted Effect probably damaging
Transcript: ENSMUST00000184882
AA Change: H91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139194
Gene: ENSMUSG00000027936
AA Change: H91R

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:TORC_M 83 239 6.5e-65 PFAM
low complexity region 250 299 N/A INTRINSIC
low complexity region 306 331 N/A INTRINSIC
low complexity region 347 354 N/A INTRINSIC
low complexity region 399 409 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
Meta Mutation Damage Score 0.3758 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 91.6%
  • 20x: 72.5%
Validation Efficiency 75% (45/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating corticosterone levels, hepatocyte secretion of glucose in response to glucagon, and glycogen levels in liver and muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,392 probably null Het
Aff2 CA CAAA X: 69,849,105 probably null Het
Ankrd34a A G 3: 96,597,789 D103G probably damaging Het
Atp1b2 T C 11: 69,601,562 D224G probably damaging Het
Atxn10 A G 15: 85,336,529 D22G possibly damaging Het
B230118H07Rik G A 2: 101,586,430 S58L probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Caskin1 C T 17: 24,504,622 L795F possibly damaging Het
Cdk12 T C 11: 98,241,831 probably null Het
Dbt A G 3: 116,539,087 probably null Het
Dda1 C A 8: 71,472,233 Y41* probably null Het
Dnah2 T A 11: 69,435,249 D3692V probably damaging Het
Dpep1 A G 8: 123,200,708 T334A probably benign Het
Enthd1 C T 15: 80,534,494 probably null Het
Fpr-rs6 T A 17: 20,182,479 I207F probably benign Het
Fsip2 T A 2: 82,985,177 S3751R possibly damaging Het
Gigyf2 A T 1: 87,428,688 probably benign Het
Gtf3c4 C A 2: 28,840,128 D34Y probably benign Het
Igfn1 A T 1: 135,962,052 V2419E probably damaging Het
Kank1 A T 19: 25,409,283 I79L probably benign Het
Kif21b A G 1: 136,171,219 H1415R probably benign Het
Mad2l1 T C 6: 66,539,878 S185P possibly damaging Het
Mettl18 A G 1: 163,996,422 E104G probably damaging Het
Mrgprb2 G A 7: 48,552,777 H67Y possibly damaging Het
Mrgprd G A 7: 145,321,702 M103I probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Nucks1 A G 1: 131,924,591 D60G probably damaging Het
Olfr1245 T A 2: 89,574,958 Y256F probably damaging Het
Olfr275 G C 4: 52,825,613 W72S probably damaging Het
Olfr978 A G 9: 39,994,544 I245V probably benign Het
Paqr8 A G 1: 20,935,047 T142A probably benign Het
Pdss1 T C 2: 22,906,831 S119P probably damaging Het
Plcl2 A G 17: 50,607,643 D560G probably benign Het
Ppm1b T A 17: 84,994,103 V137E probably damaging Het
Ppp1r16b A C 2: 158,696,063 K35Q probably damaging Het
Prkd2 A T 7: 16,869,890 E832V probably damaging Het
Rab34 G T 11: 78,191,406 K191N possibly damaging Het
Rad51ap2 A C 12: 11,458,539 T821P probably benign Het
Rbm19 A G 5: 120,144,046 T823A probably benign Het
Rpf2 T G 10: 40,227,601 H106P probably damaging Het
Schip1 A G 3: 68,625,844 M453V probably benign Het
Sema5a T A 15: 32,562,774 N310K possibly damaging Het
Sf3b1 T C 1: 54,990,306 D1179G probably damaging Het
Skint2 A T 4: 112,616,532 T4S possibly damaging Het
Slc22a5 A T 11: 53,869,415 Y358* probably null Het
Slc34a1 T C 13: 55,409,101 M251T probably benign Het
Slc44a5 A G 3: 154,239,118 D124G probably null Het
Slc9b1 G A 3: 135,357,673 E73K unknown Het
Ssbp2 T C 13: 91,669,710 L156P probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Trim47 A G 11: 116,106,227 V568A probably damaging Het
Ttn A T 2: 76,887,980 probably benign Het
Ttpa A T 4: 20,021,260 I74F probably damaging Het
Vmn2r52 T C 7: 10,171,388 I175V probably benign Het
Wrn C T 8: 33,240,983 C1350Y probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp422 A T 6: 116,626,611 D142E probably damaging Het
Zfp473 A T 7: 44,733,188 C574S probably damaging Het
Zfp638 T A 6: 83,928,964 M37K probably damaging Het
Zfp976 C A 7: 42,642,524 probably benign Het
Other mutations in Crtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Crtc2 APN 3 90260805 missense probably damaging 0.98
IGL01874:Crtc2 APN 3 90258508 missense probably damaging 1.00
IGL02220:Crtc2 APN 3 90259148 splice site probably benign
IGL02454:Crtc2 APN 3 90259167 missense probably benign 0.00
IGL02957:Crtc2 APN 3 90262533 missense probably damaging 1.00
R0492:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0707:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0751:Crtc2 UTSW 3 90262633 nonsense probably null
R1184:Crtc2 UTSW 3 90262633 nonsense probably null
R1521:Crtc2 UTSW 3 90257383 missense probably benign 0.10
R3856:Crtc2 UTSW 3 90262570 missense probably damaging 1.00
R4283:Crtc2 UTSW 3 90259236 splice site probably benign
R4747:Crtc2 UTSW 3 90260211 missense probably damaging 1.00
R5293:Crtc2 UTSW 3 90263564 missense probably benign
R5302:Crtc2 UTSW 3 90261018 missense probably damaging 1.00
R5314:Crtc2 UTSW 3 90261041 nonsense probably null
R6170:Crtc2 UTSW 3 90259600 missense probably benign
R6887:Crtc2 UTSW 3 90261071 missense probably damaging 0.99
R7067:Crtc2 UTSW 3 90260182 missense probably benign 0.44
R7506:Crtc2 UTSW 3 90259212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTAACAGGTGATGGCCCTTGAC -3'
(R):5'- AGGCAGCCAAGACTATTCCCTGAC -3'

Sequencing Primer
(F):5'- GATGGCCCTTGACTTCCTTAG -3'
(R):5'- CTGGTAAGGAACACATACCTTTAGC -3'
Posted On2013-04-16