Incidental Mutation 'R2088:Olfr1289'
ID231564
Institutional Source Beutler Lab
Gene Symbol Olfr1289
Ensembl Gene ENSMUSG00000061195
Gene Nameolfactory receptor 1289
SynonymsGA_x6K02T2Q125-72534883-72535821, MOR245-6
MMRRC Submission 040093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R2088 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111480819-111484615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 111484278 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 283 (A283S)
Ref Sequence ENSEMBL: ENSMUSP00000147119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099616] [ENSMUST00000102551] [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816] [ENSMUST00000217611]
Predicted Effect probably benign
Transcript: ENSMUST00000099616
SMART Domains Protein: ENSMUSP00000097211
Gene: ENSMUSG00000095809

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.5e-52 PFAM
Pfam:7tm_1 41 287 1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102551
AA Change: A283S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099611
Gene: ENSMUSG00000108908
AA Change: A283S

DomainStartEndE-ValueType
Pfam:7tm_4 17 289 6e-45 PFAM
Pfam:7TM_GPCR_Srsx 20 288 1.4e-7 PFAM
Pfam:7tm_1 27 273 7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104889
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120021
AA Change: A311S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000207494
AA Change: A283S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207707
Predicted Effect probably benign
Transcript: ENSMUST00000214816
Predicted Effect probably benign
Transcript: ENSMUST00000217611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Meta Mutation Damage Score 0.6102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik T C 9: 58,499,005 F66S probably damaging Het
Ankk1 T C 9: 49,421,965 probably benign Het
Ano5 T A 7: 51,587,706 N759K possibly damaging Het
Arhgef10 A G 8: 14,983,898 T1072A possibly damaging Het
BC107364 T C 3: 96,434,429 T93A unknown Het
Canx C T 11: 50,310,390 E97K possibly damaging Het
Casp8ap2 T C 4: 32,631,126 L62P probably damaging Het
Cbfa2t3 C T 8: 122,637,986 probably benign Het
Cmya5 A T 13: 93,092,812 S1923T probably damaging Het
Cntnap1 T A 11: 101,182,547 I618N probably damaging Het
Cox17 C G 16: 38,347,180 P27R probably damaging Het
Ctnna3 A G 10: 64,873,207 E675G probably damaging Het
Cul9 A G 17: 46,526,649 L990P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Fhdc1 T C 3: 84,474,726 probably benign Het
Fryl T A 5: 73,065,461 I1926F probably benign Het
Galnt4 A G 10: 99,109,184 D257G probably damaging Het
Gatm A G 2: 122,598,148 V344A probably benign Het
Gli1 T G 10: 127,331,500 Y628S probably damaging Het
Gpr1 A T 1: 63,183,652 probably null Het
Gsdmc3 A C 15: 63,860,214 probably null Het
Hap1 T C 11: 100,356,002 T26A probably benign Het
Helz2 C T 2: 181,235,102 G1200S probably benign Het
Iqgap2 C T 13: 95,891,663 probably null Het
Itga3 T A 11: 95,052,494 I895F probably benign Het
Klhl33 A T 14: 50,892,773 C421* probably null Het
Klra2 T C 6: 131,242,826 T131A probably damaging Het
Krt14 T C 11: 100,204,123 E426G possibly damaging Het
Limd2 A G 11: 106,158,742 F107L probably damaging Het
Lipo4 A T 19: 33,500,069 N318K possibly damaging Het
Mab21l2 T G 3: 86,547,009 D228A probably damaging Het
Moxd2 G A 6: 40,884,967 H224Y probably damaging Het
Mpp4 T C 1: 59,123,465 Y521C possibly damaging Het
Msto1 C T 3: 88,910,990 A317T probably damaging Het
Mtmr4 T C 11: 87,610,967 S559P probably damaging Het
Muc4 T A 16: 32,756,409 H2094Q unknown Het
Ndufa11 C A 17: 56,717,922 T28K probably damaging Het
Olfr124 A G 17: 37,805,795 T217A probably benign Het
Orai2 C A 5: 136,150,756 R155L probably damaging Het
Pde4c A G 8: 70,749,356 D582G possibly damaging Het
Pde4dip T C 3: 97,754,433 E609G probably null Het
Prune2 A G 19: 17,119,745 D871G possibly damaging Het
Rbpms2 T A 9: 65,630,839 L4Q probably damaging Het
Rhbg T C 3: 88,247,458 Y213C probably damaging Het
Rplp0 T A 5: 115,562,503 N243K possibly damaging Het
Rtp4 A T 16: 23,613,213 H165L possibly damaging Het
Ryr2 C A 13: 11,662,229 M3245I probably benign Het
Sh2b2 T A 5: 136,232,114 M83L possibly damaging Het
Simc1 T C 13: 54,541,534 I284T probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
St6galnac1 A G 11: 116,769,107 S127P probably benign Het
Tatdn3 A G 1: 191,052,876 I192T possibly damaging Het
Tmem25 C A 9: 44,796,086 V239F possibly damaging Het
Tprkb A C 6: 85,932,940 probably benign Het
Trappc10 A G 10: 78,196,334 V1040A probably benign Het
Txnrd1 G A 10: 82,883,910 probably benign Het
Uhrf1 A T 17: 56,318,089 K544M probably damaging Het
Unc80 T A 1: 66,590,227 H1294Q possibly damaging Het
Uspl1 T A 5: 149,209,750 I437K probably damaging Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Vmn2r19 A T 6: 123,335,836 I622F probably damaging Het
Znfx1 A G 2: 167,055,810 F398S probably damaging Het
Other mutations in Olfr1289
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr1289 APN 2 111484101 missense probably damaging 1.00
IGL01682:Olfr1289 APN 2 111483843 missense probably damaging 1.00
IGL02028:Olfr1289 APN 2 111483471 missense probably benign 0.01
IGL02731:Olfr1289 APN 2 111483528 missense probably benign 0.00
IGL03035:Olfr1289 APN 2 111483823 missense probably benign 0.04
R1214:Olfr1289 UTSW 2 111483892 missense probably damaging 1.00
R1471:Olfr1289 UTSW 2 111484006 missense probably damaging 1.00
R1714:Olfr1289 UTSW 2 111483663 missense probably damaging 1.00
R2136:Olfr1289 UTSW 2 111483616 missense probably damaging 1.00
R2141:Olfr1289 UTSW 2 111483630 missense probably benign 0.23
R3945:Olfr1289 UTSW 2 111483687 nonsense probably null
R4276:Olfr1289 UTSW 2 111483504 missense probably damaging 1.00
R4562:Olfr1289 UTSW 2 111483564 missense probably benign 0.00
R4896:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R4946:Olfr1289 UTSW 2 111483966 missense possibly damaging 0.93
R5004:Olfr1289 UTSW 2 111483660 missense possibly damaging 0.82
R5686:Olfr1289 UTSW 2 111484143 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6032:Olfr1289 UTSW 2 111483850 missense probably damaging 1.00
R6960:Olfr1289 UTSW 2 111483726 missense possibly damaging 0.70
R7293:Olfr1289 UTSW 2 111483354 splice site probably null
R7642:Olfr1289 UTSW 2 111483478 missense probably damaging 0.96
R8429:Olfr1289 UTSW 2 111483495 missense possibly damaging 0.55
R8447:Olfr1289 UTSW 2 111483756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCTCATATCACAGTAGTTC -3'
(R):5'- CAGTTGTACTCAAATAGCACCG -3'

Sequencing Primer
(F):5'- TGCTCATATCACAGTAGTTCTTTTG -3'
(R):5'- GTCCTAAAATCTAGTGAAAAGGT -3'
Posted On2014-09-18