Incidental Mutation 'R2088:Gatm'
ID 231565
Institutional Source Beutler Lab
Gene Symbol Gatm
Ensembl Gene ENSMUSG00000027199
Gene Name glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Synonyms 1810003P21Rik
MMRRC Submission 040093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2088 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 122594467-122611303 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122598148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 344 (V344A)
Ref Sequence ENSEMBL: ENSMUSP00000028624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028624]
AlphaFold Q9D964
Predicted Effect probably benign
Transcript: ENSMUST00000028624
AA Change: V344A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028624
Gene: ENSMUSG00000027199
AA Change: V344A

DomainStartEndE-ValueType
Pfam:Amidinotransf 254 414 3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154598
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme that belongs to the amidinotransferase family. This enzyme is involved in creatine biosynthesis, whereby it catalyzes the transfer of a guanido group from L-arginine to glycine, resulting in guanidinoacetic acid, the immediate precursor of creatine. Mutations in this gene cause arginine:glycine amidinotransferase deficiency, an inborn error of creatine synthesis characterized by mental retardation, language impairment, and behavioral disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance obesity, reduced adipocity and improved glucose homeostasis when fed a high fat diet. Mice homozygous for an ENU-induced allele exhibit increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik T C 9: 58,499,005 F66S probably damaging Het
Ankk1 T C 9: 49,421,965 probably benign Het
Ano5 T A 7: 51,587,706 N759K possibly damaging Het
Arhgef10 A G 8: 14,983,898 T1072A possibly damaging Het
BC107364 T C 3: 96,434,429 T93A unknown Het
Canx C T 11: 50,310,390 E97K possibly damaging Het
Casp8ap2 T C 4: 32,631,126 L62P probably damaging Het
Cbfa2t3 C T 8: 122,637,986 probably benign Het
Cmya5 A T 13: 93,092,812 S1923T probably damaging Het
Cntnap1 T A 11: 101,182,547 I618N probably damaging Het
Cox17 C G 16: 38,347,180 P27R probably damaging Het
Ctnna3 A G 10: 64,873,207 E675G probably damaging Het
Cul9 A G 17: 46,526,649 L990P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Fhdc1 T C 3: 84,474,726 probably benign Het
Fryl T A 5: 73,065,461 I1926F probably benign Het
Galnt4 A G 10: 99,109,184 D257G probably damaging Het
Gli1 T G 10: 127,331,500 Y628S probably damaging Het
Gpr1 A T 1: 63,183,652 probably null Het
Gsdmc3 A C 15: 63,860,214 probably null Het
Hap1 T C 11: 100,356,002 T26A probably benign Het
Helz2 C T 2: 181,235,102 G1200S probably benign Het
Iqgap2 C T 13: 95,891,663 probably null Het
Itga3 T A 11: 95,052,494 I895F probably benign Het
Klhl33 A T 14: 50,892,773 C421* probably null Het
Klra2 T C 6: 131,242,826 T131A probably damaging Het
Krt14 T C 11: 100,204,123 E426G possibly damaging Het
Limd2 A G 11: 106,158,742 F107L probably damaging Het
Lipo4 A T 19: 33,500,069 N318K possibly damaging Het
Mab21l2 T G 3: 86,547,009 D228A probably damaging Het
Moxd2 G A 6: 40,884,967 H224Y probably damaging Het
Mpp4 T C 1: 59,123,465 Y521C possibly damaging Het
Msto1 C T 3: 88,910,990 A317T probably damaging Het
Mtmr4 T C 11: 87,610,967 S559P probably damaging Het
Muc4 T A 16: 32,756,409 H2094Q unknown Het
Ndufa11 C A 17: 56,717,922 T28K probably damaging Het
Olfr124 A G 17: 37,805,795 T217A probably benign Het
Olfr1289 G T 2: 111,484,278 A283S probably damaging Het
Orai2 C A 5: 136,150,756 R155L probably damaging Het
Pde4c A G 8: 70,749,356 D582G possibly damaging Het
Pde4dip T C 3: 97,754,433 E609G probably null Het
Prune2 A G 19: 17,119,745 D871G possibly damaging Het
Rbpms2 T A 9: 65,630,839 L4Q probably damaging Het
Rhbg T C 3: 88,247,458 Y213C probably damaging Het
Rplp0 T A 5: 115,562,503 N243K possibly damaging Het
Rtp4 A T 16: 23,613,213 H165L possibly damaging Het
Ryr2 C A 13: 11,662,229 M3245I probably benign Het
Sh2b2 T A 5: 136,232,114 M83L possibly damaging Het
Simc1 T C 13: 54,541,534 I284T probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
St6galnac1 A G 11: 116,769,107 S127P probably benign Het
Tatdn3 A G 1: 191,052,876 I192T possibly damaging Het
Tmem25 C A 9: 44,796,086 V239F possibly damaging Het
Tprkb A C 6: 85,932,940 probably benign Het
Trappc10 A G 10: 78,196,334 V1040A probably benign Het
Txnrd1 G A 10: 82,883,910 probably benign Het
Uhrf1 A T 17: 56,318,089 K544M probably damaging Het
Unc80 T A 1: 66,590,227 H1294Q possibly damaging Het
Uspl1 T A 5: 149,209,750 I437K probably damaging Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Vmn2r19 A T 6: 123,335,836 I622F probably damaging Het
Znfx1 A G 2: 167,055,810 F398S probably damaging Het
Other mutations in Gatm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gatm APN 2 122600825 missense possibly damaging 0.49
IGL03059:Gatm APN 2 122609700 missense probably damaging 1.00
mrbig UTSW 2 122600744 missense probably damaging 1.00
staggering UTSW 2 122595537 missense probably damaging 1.00
Weighted UTSW 2 122609660 splice site probably benign
R0046:Gatm UTSW 2 122600744 missense probably damaging 1.00
R0046:Gatm UTSW 2 122600744 missense probably damaging 1.00
R1004:Gatm UTSW 2 122609660 splice site probably benign
R2128:Gatm UTSW 2 122600536 missense probably damaging 1.00
R4027:Gatm UTSW 2 122597446 missense probably damaging 1.00
R5155:Gatm UTSW 2 122609853 missense probably benign 0.04
R5183:Gatm UTSW 2 122595503 missense probably benign 0.01
R5517:Gatm UTSW 2 122595543 missense probably damaging 1.00
R5804:Gatm UTSW 2 122602602 missense probably benign 0.01
R5842:Gatm UTSW 2 122603627 missense probably benign
R6362:Gatm UTSW 2 122598196 missense probably benign 0.06
R8136:Gatm UTSW 2 122595537 missense probably damaging 1.00
R8199:Gatm UTSW 2 122602513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGTTAGACATTTGGAATCCATC -3'
(R):5'- TGCTTACCCACCAGAGCATG -3'

Sequencing Primer
(F):5'- CAAACACATGTTGCAGCC -3'
(R):5'- TTCTTGTACAGACCCGATACAGG -3'
Posted On 2014-09-18