Incidental Mutation 'R2088:Rhbg'
ID231570
Institutional Source Beutler Lab
Gene Symbol Rhbg
Ensembl Gene ENSMUSG00000104445
Gene NameRhesus blood group-associated B glycoprotein
Synonyms
MMRRC Submission 040093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2088 (G1)
Quality Score208
Status Validated
Chromosome3
Chromosomal Location88242874-88254709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88247458 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 213 (Y213C)
Ref Sequence ENSEMBL: ENSMUSP00000130767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171887]
Predicted Effect probably benign
Transcript: ENSMUST00000163277
Predicted Effect unknown
Transcript: ENSMUST00000165196
AA Change: Y191C
SMART Domains Protein: ENSMUSP00000132187
Gene: ENSMUSG00000103766
AA Change: Y191C

DomainStartEndE-ValueType
Pfam:Ammonium_transp 1 353 9.7e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171887
AA Change: Y213C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130767
Gene: ENSMUSG00000104445
AA Change: Y213C

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:Ammonium_transp 22 419 5.9e-74 PFAM
Meta Mutation Damage Score 0.5893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-erythroid members of the Rhesus (Rh) protein family. Non-erythroid Rh protein family members are mainly expressed in the kidney and belong to the methylammonium-ammonium permease/ammonia transporters superfamily. All Rh family proteins are predicted to be transmembrane proteins with 12 membrane spanning domains and intracytoplasmic N- and C-termini. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, do not develop hyperammonemic hepatic encephalopathy or distal tubular acidosis, and show a normal renal response to chronic acid-loading and no changes in NH4+ or NH3 entry across the basolateral membrane of cortical collecting ducts cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik T C 9: 58,499,005 F66S probably damaging Het
Ankk1 T C 9: 49,421,965 probably benign Het
Ano5 T A 7: 51,587,706 N759K possibly damaging Het
Arhgef10 A G 8: 14,983,898 T1072A possibly damaging Het
BC107364 T C 3: 96,434,429 T93A unknown Het
Canx C T 11: 50,310,390 E97K possibly damaging Het
Casp8ap2 T C 4: 32,631,126 L62P probably damaging Het
Cbfa2t3 C T 8: 122,637,986 probably benign Het
Cmya5 A T 13: 93,092,812 S1923T probably damaging Het
Cntnap1 T A 11: 101,182,547 I618N probably damaging Het
Cox17 C G 16: 38,347,180 P27R probably damaging Het
Ctnna3 A G 10: 64,873,207 E675G probably damaging Het
Cul9 A G 17: 46,526,649 L990P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Fhdc1 T C 3: 84,474,726 probably benign Het
Fryl T A 5: 73,065,461 I1926F probably benign Het
Galnt4 A G 10: 99,109,184 D257G probably damaging Het
Gatm A G 2: 122,598,148 V344A probably benign Het
Gli1 T G 10: 127,331,500 Y628S probably damaging Het
Gpr1 A T 1: 63,183,652 probably null Het
Gsdmc3 A C 15: 63,860,214 probably null Het
Hap1 T C 11: 100,356,002 T26A probably benign Het
Helz2 C T 2: 181,235,102 G1200S probably benign Het
Iqgap2 C T 13: 95,891,663 probably null Het
Itga3 T A 11: 95,052,494 I895F probably benign Het
Klhl33 A T 14: 50,892,773 C421* probably null Het
Klra2 T C 6: 131,242,826 T131A probably damaging Het
Krt14 T C 11: 100,204,123 E426G possibly damaging Het
Limd2 A G 11: 106,158,742 F107L probably damaging Het
Lipo4 A T 19: 33,500,069 N318K possibly damaging Het
Mab21l2 T G 3: 86,547,009 D228A probably damaging Het
Moxd2 G A 6: 40,884,967 H224Y probably damaging Het
Mpp4 T C 1: 59,123,465 Y521C possibly damaging Het
Msto1 C T 3: 88,910,990 A317T probably damaging Het
Mtmr4 T C 11: 87,610,967 S559P probably damaging Het
Muc4 T A 16: 32,756,409 H2094Q unknown Het
Ndufa11 C A 17: 56,717,922 T28K probably damaging Het
Olfr124 A G 17: 37,805,795 T217A probably benign Het
Olfr1289 G T 2: 111,484,278 A283S probably damaging Het
Orai2 C A 5: 136,150,756 R155L probably damaging Het
Pde4c A G 8: 70,749,356 D582G possibly damaging Het
Pde4dip T C 3: 97,754,433 E609G probably null Het
Prune2 A G 19: 17,119,745 D871G possibly damaging Het
Rbpms2 T A 9: 65,630,839 L4Q probably damaging Het
Rplp0 T A 5: 115,562,503 N243K possibly damaging Het
Rtp4 A T 16: 23,613,213 H165L possibly damaging Het
Ryr2 C A 13: 11,662,229 M3245I probably benign Het
Sh2b2 T A 5: 136,232,114 M83L possibly damaging Het
Simc1 T C 13: 54,541,534 I284T probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
St6galnac1 A G 11: 116,769,107 S127P probably benign Het
Tatdn3 A G 1: 191,052,876 I192T possibly damaging Het
Tmem25 C A 9: 44,796,086 V239F possibly damaging Het
Tprkb A C 6: 85,932,940 probably benign Het
Trappc10 A G 10: 78,196,334 V1040A probably benign Het
Txnrd1 G A 10: 82,883,910 probably benign Het
Uhrf1 A T 17: 56,318,089 K544M probably damaging Het
Unc80 T A 1: 66,590,227 H1294Q possibly damaging Het
Uspl1 T A 5: 149,209,750 I437K probably damaging Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Vmn2r19 A T 6: 123,335,836 I622F probably damaging Het
Znfx1 A G 2: 167,055,810 F398S probably damaging Het
Other mutations in Rhbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Rhbg UTSW 3 88254498 missense probably benign
R0786:Rhbg UTSW 3 88244568 missense probably benign 0.04
R1397:Rhbg UTSW 3 88248446 missense probably benign 0.14
R1737:Rhbg UTSW 3 88245874 missense probably damaging 1.00
R1927:Rhbg UTSW 3 88244552 missense probably benign 0.00
R3976:Rhbg UTSW 3 88244536 missense probably damaging 1.00
R4056:Rhbg UTSW 3 88243448 missense probably damaging 1.00
R4669:Rhbg UTSW 3 88245966 missense probably damaging 1.00
R4878:Rhbg UTSW 3 88247453 missense probably benign 0.43
R5032:Rhbg UTSW 3 88245134 missense probably damaging 1.00
R5330:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5331:Rhbg UTSW 3 88245468 missense probably benign 0.10
R5788:Rhbg UTSW 3 88245567 missense probably benign 0.00
R6293:Rhbg UTSW 3 88245826 nonsense probably null
R6882:Rhbg UTSW 3 88245220 missense probably damaging 1.00
R7493:Rhbg UTSW 3 88247579 missense probably damaging 1.00
R8024:Rhbg UTSW 3 88248453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGTCATAAGTTAGGGGCAG -3'
(R):5'- TGCTAATGGCTCTACTGGAGG -3'

Sequencing Primer
(F):5'- GAGATGAGCACAGATCTCAGGCC -3'
(R):5'- GCGTCAACGAGTTTATACTACTCAG -3'
Posted On2014-09-18