Mutagenetix > Incidental Mutation

Incidental Mutation 'R2088:Sh2b2'

231580

Institutional Source

Beutler Lab

Gene Symbol

Sh2b2

Ensembl Gene

ENSMUSG00000005057

Gene Name

SH2B adaptor protein 2

Synonyms

Aps

MMRRC Submission

040093-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R2088 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136218147-136246556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 136232114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 83 (M83L)

Ref Sequence

ENSEMBL: ENSMUSP00000142728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196245] [ENSMUST00000196397] [ENSMUST00000196447]

AlphaFold

Q9JID9

Predicted Effect

probably benign
Transcript: ENSMUST00000005188
AA Change: M83L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: M83L

Domain	Start	End	E-Value	Type
low complexity region	6	16	N/A	INTRINSIC
Pfam:Phe_ZIP	17	73	9.3e-22	PFAM
Blast:PH	95	168	2e-21	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	4.97e-9	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
SH2	407	492	1.38e-21	SMART
low complexity region	509	525	N/A	INTRINSIC
low complexity region	548	576	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196245

Predicted Effect

probably benign
Transcript: ENSMUST00000196397
AA Change: M83L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: M83L

Domain	Start	End	E-Value	Type
Pfam:Phe_ZIP	16	74	1.5e-30	PFAM
Blast:PH	95	168	2e-21	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	4.97e-9	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	388	404	N/A	INTRINSIC
SH2	407	492	1.38e-21	SMART
low complexity region	509	525	N/A	INTRINSIC
low complexity region	548	576	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196447
AA Change: M83L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: M83L

Domain	Start	End	E-Value	Type
Pfam:Phe_ZIP	16	74	9.1e-28	PFAM
Blast:PH	95	168	9e-22	BLAST
low complexity region	169	180	N/A	INTRINSIC
PH	187	301	2.2e-11	SMART
low complexity region	340	350	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	T	C	9: 58,499,005	F66S	probably damaging	Het
Ankk1	T	C	9: 49,421,965		probably benign	Het
Ano5	T	A	7: 51,587,706	N759K	possibly damaging	Het
Arhgef10	A	G	8: 14,983,898	T1072A	possibly damaging	Het
BC107364	T	C	3: 96,434,429	T93A	unknown	Het
Canx	C	T	11: 50,310,390	E97K	possibly damaging	Het
Casp8ap2	T	C	4: 32,631,126	L62P	probably damaging	Het
Cbfa2t3	C	T	8: 122,637,986		probably benign	Het
Cmya5	A	T	13: 93,092,812	S1923T	probably damaging	Het
Cntnap1	T	A	11: 101,182,547	I618N	probably damaging	Het
Cox17	C	G	16: 38,347,180	P27R	probably damaging	Het
Ctnna3	A	G	10: 64,873,207	E675G	probably damaging	Het
Cul9	A	G	17: 46,526,649	L990P	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Eif2d	T	C	1: 131,164,727	V374A	probably damaging	Het
Fhdc1	T	C	3: 84,474,726		probably benign	Het
Fryl	T	A	5: 73,065,461	I1926F	probably benign	Het
Galnt4	A	G	10: 99,109,184	D257G	probably damaging	Het
Gatm	A	G	2: 122,598,148	V344A	probably benign	Het
Gli1	T	G	10: 127,331,500	Y628S	probably damaging	Het
Gpr1	A	T	1: 63,183,652		probably null	Het
Gsdmc3	A	C	15: 63,860,214		probably null	Het
Hap1	T	C	11: 100,356,002	T26A	probably benign	Het
Helz2	C	T	2: 181,235,102	G1200S	probably benign	Het
Iqgap2	C	T	13: 95,891,663		probably null	Het
Itga3	T	A	11: 95,052,494	I895F	probably benign	Het
Klhl33	A	T	14: 50,892,773	C421*	probably null	Het
Klra2	T	C	6: 131,242,826	T131A	probably damaging	Het
Krt14	T	C	11: 100,204,123	E426G	possibly damaging	Het
Limd2	A	G	11: 106,158,742	F107L	probably damaging	Het
Lipo4	A	T	19: 33,500,069	N318K	possibly damaging	Het
Mab21l2	T	G	3: 86,547,009	D228A	probably damaging	Het
Moxd2	G	A	6: 40,884,967	H224Y	probably damaging	Het
Mpp4	T	C	1: 59,123,465	Y521C	possibly damaging	Het
Msto1	C	T	3: 88,910,990	A317T	probably damaging	Het
Mtmr4	T	C	11: 87,610,967	S559P	probably damaging	Het
Muc4	T	A	16: 32,756,409	H2094Q	unknown	Het
Ndufa11	C	A	17: 56,717,922	T28K	probably damaging	Het
Olfr124	A	G	17: 37,805,795	T217A	probably benign	Het
Olfr1289	G	T	2: 111,484,278	A283S	probably damaging	Het
Orai2	C	A	5: 136,150,756	R155L	probably damaging	Het
Pde4c	A	G	8: 70,749,356	D582G	possibly damaging	Het
Pde4dip	T	C	3: 97,754,433	E609G	probably null	Het
Prune2	A	G	19: 17,119,745	D871G	possibly damaging	Het
Rbpms2	T	A	9: 65,630,839	L4Q	probably damaging	Het
Rhbg	T	C	3: 88,247,458	Y213C	probably damaging	Het
Rplp0	T	A	5: 115,562,503	N243K	possibly damaging	Het
Rtp4	A	T	16: 23,613,213	H165L	possibly damaging	Het
Ryr2	C	A	13: 11,662,229	M3245I	probably benign	Het
Simc1	T	C	13: 54,541,534	I284T	probably damaging	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc46a1	T	C	11: 78,468,645	S368P	possibly damaging	Het
St6galnac1	A	G	11: 116,769,107	S127P	probably benign	Het
Tatdn3	A	G	1: 191,052,876	I192T	possibly damaging	Het
Tmem25	C	A	9: 44,796,086	V239F	possibly damaging	Het
Tprkb	A	C	6: 85,932,940		probably benign	Het
Trappc10	A	G	10: 78,196,334	V1040A	probably benign	Het
Txnrd1	G	A	10: 82,883,910		probably benign	Het
Uhrf1	A	T	17: 56,318,089	K544M	probably damaging	Het
Unc80	T	A	1: 66,590,227	H1294Q	possibly damaging	Het
Uspl1	T	A	5: 149,209,750	I437K	probably damaging	Het
Vmn1r232	A	T	17: 20,913,737	N200K	possibly damaging	Het
Vmn2r19	A	T	6: 123,335,836	I622F	probably damaging	Het
Znfx1	A	G	2: 167,055,810	F398S	probably damaging	Het

Other mutations in Sh2b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sh2b2	APN	5	136224419	missense	probably damaging	1.00
IGL01456:Sh2b2	APN	5	136224467	missense	probably damaging	0.98
IGL01612:Sh2b2	APN	5	136231802	missense	probably benign	0.02
IGL02798:Sh2b2	APN	5	136221963	missense	probably damaging	1.00
BB002:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
BB012:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
R0492:Sh2b2	UTSW	5	136232263	missense	probably damaging	1.00
R0539:Sh2b2	UTSW	5	136225301	splice site	probably benign
R0707:Sh2b2	UTSW	5	136232263	missense	probably damaging	1.00
R1569:Sh2b2	UTSW	5	136231735	missense	possibly damaging	0.89
R1777:Sh2b2	UTSW	5	136227422	missense	probably damaging	1.00
R3702:Sh2b2	UTSW	5	136224233	missense	probably damaging	0.99
R4223:Sh2b2	UTSW	5	136219053	missense	possibly damaging	0.91
R4597:Sh2b2	UTSW	5	136231762	missense	probably damaging	0.99
R4683:Sh2b2	UTSW	5	136231720	missense	probably damaging	1.00
R4766:Sh2b2	UTSW	5	136231957	missense	probably damaging	0.99
R5486:Sh2b2	UTSW	5	136232090	missense	probably benign	0.10
R6060:Sh2b2	UTSW	5	136232355	missense	possibly damaging	0.72
R6322:Sh2b2	UTSW	5	136224188	missense	probably damaging	0.99
R7020:Sh2b2	UTSW	5	136224299	missense	possibly damaging	0.69
R7034:Sh2b2	UTSW	5	136218885	missense	probably benign	0.18
R7036:Sh2b2	UTSW	5	136218885	missense	probably benign	0.18
R7615:Sh2b2	UTSW	5	136219657	missense	probably damaging	1.00
R7715:Sh2b2	UTSW	5	136219035	missense	probably benign	0.09
R7925:Sh2b2	UTSW	5	136224261	missense	probably benign	0.04
R8244:Sh2b2	UTSW	5	136227437	nonsense	probably null
R8291:Sh2b2	UTSW	5	136232355	missense	possibly damaging	0.72
R8786:Sh2b2	UTSW	5	136231804	missense	probably benign	0.29
R9293:Sh2b2	UTSW	5	136232039	missense	possibly damaging	0.90
R9364:Sh2b2	UTSW	5	136224152	missense	probably benign	0.03
R9554:Sh2b2	UTSW	5	136224152	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ATTTGTCACGAGGCTCCGAC -3'
(R):5'- CATGGGACCAAAGCCATGAATG -3'

Sequencing Primer
(F):5'- CCACCATCGGGCTCTGG -3'
(R):5'- GCAATTCTGCGAGCTGC -3'

Posted On

2014-09-18