Incidental Mutation 'R2088:Cbfa2t3'
ID 231590
Institutional Source Beutler Lab
Gene Symbol Cbfa2t3
Ensembl Gene ENSMUSG00000006362
Gene Name core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human)
Synonyms MTGR2, ETO-2, Eto2, A630044F12Rik
MMRRC Submission 040093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2088 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 122625141-122699109 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 122637986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006525] [ENSMUST00000064674] [ENSMUST00000127664] [ENSMUST00000127984] [ENSMUST00000134045]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006525
SMART Domains Protein: ENSMUSP00000006525
Gene: ENSMUSG00000006362

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 87 177 5.46e-52 SMART
low complexity region 248 257 N/A INTRINSIC
Pfam:NHR2 295 361 3.6e-41 PFAM
PDB:2KYG|C 395 424 3e-10 PDB
Pfam:zf-MYND 472 508 2.6e-10 PFAM
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064674
SMART Domains Protein: ENSMUSP00000065728
Gene: ENSMUSG00000006362

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
TAFH 113 203 5.46e-52 SMART
low complexity region 274 283 N/A INTRINSIC
Pfam:NHR2 321 387 7.1e-41 PFAM
PDB:2KYG|C 421 450 1e-10 PDB
Pfam:zf-MYND 498 534 7.1e-10 PFAM
low complexity region 555 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127984
SMART Domains Protein: ENSMUSP00000118997
Gene: ENSMUSG00000006362

DomainStartEndE-ValueType
low complexity region 47 62 N/A INTRINSIC
TAFH 148 238 5.46e-52 SMART
low complexity region 309 318 N/A INTRINSIC
Pfam:NHR2 356 422 2.3e-38 PFAM
PDB:2KYG|C 456 485 2e-10 PDB
Pfam:zf-MYND 533 569 6.9e-10 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134045
SMART Domains Protein: ENSMUSP00000117630
Gene: ENSMUSG00000006362

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:TAFH 111 185 3.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142535
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(16;21)(q24;q22) translocation is one of the less common karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. This gene is also a putative breast tumor suppressor. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice that are homozygote null for this gene display skewing of the early myeloid progenitor cells toward the granulocytic/macrophage lineage while reducing the numbers of megakaryocyte-erythroid progenitor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik T C 9: 58,499,005 F66S probably damaging Het
Ankk1 T C 9: 49,421,965 probably benign Het
Ano5 T A 7: 51,587,706 N759K possibly damaging Het
Arhgef10 A G 8: 14,983,898 T1072A possibly damaging Het
BC107364 T C 3: 96,434,429 T93A unknown Het
Canx C T 11: 50,310,390 E97K possibly damaging Het
Casp8ap2 T C 4: 32,631,126 L62P probably damaging Het
Cmya5 A T 13: 93,092,812 S1923T probably damaging Het
Cntnap1 T A 11: 101,182,547 I618N probably damaging Het
Cox17 C G 16: 38,347,180 P27R probably damaging Het
Ctnna3 A G 10: 64,873,207 E675G probably damaging Het
Cul9 A G 17: 46,526,649 L990P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Fhdc1 T C 3: 84,474,726 probably benign Het
Fryl T A 5: 73,065,461 I1926F probably benign Het
Galnt4 A G 10: 99,109,184 D257G probably damaging Het
Gatm A G 2: 122,598,148 V344A probably benign Het
Gli1 T G 10: 127,331,500 Y628S probably damaging Het
Gpr1 A T 1: 63,183,652 probably null Het
Gsdmc3 A C 15: 63,860,214 probably null Het
Hap1 T C 11: 100,356,002 T26A probably benign Het
Helz2 C T 2: 181,235,102 G1200S probably benign Het
Iqgap2 C T 13: 95,891,663 probably null Het
Itga3 T A 11: 95,052,494 I895F probably benign Het
Klhl33 A T 14: 50,892,773 C421* probably null Het
Klra2 T C 6: 131,242,826 T131A probably damaging Het
Krt14 T C 11: 100,204,123 E426G possibly damaging Het
Limd2 A G 11: 106,158,742 F107L probably damaging Het
Lipo4 A T 19: 33,500,069 N318K possibly damaging Het
Mab21l2 T G 3: 86,547,009 D228A probably damaging Het
Moxd2 G A 6: 40,884,967 H224Y probably damaging Het
Mpp4 T C 1: 59,123,465 Y521C possibly damaging Het
Msto1 C T 3: 88,910,990 A317T probably damaging Het
Mtmr4 T C 11: 87,610,967 S559P probably damaging Het
Muc4 T A 16: 32,756,409 H2094Q unknown Het
Ndufa11 C A 17: 56,717,922 T28K probably damaging Het
Olfr124 A G 17: 37,805,795 T217A probably benign Het
Olfr1289 G T 2: 111,484,278 A283S probably damaging Het
Orai2 C A 5: 136,150,756 R155L probably damaging Het
Pde4c A G 8: 70,749,356 D582G possibly damaging Het
Pde4dip T C 3: 97,754,433 E609G probably null Het
Prune2 A G 19: 17,119,745 D871G possibly damaging Het
Rbpms2 T A 9: 65,630,839 L4Q probably damaging Het
Rhbg T C 3: 88,247,458 Y213C probably damaging Het
Rplp0 T A 5: 115,562,503 N243K possibly damaging Het
Rtp4 A T 16: 23,613,213 H165L possibly damaging Het
Ryr2 C A 13: 11,662,229 M3245I probably benign Het
Sh2b2 T A 5: 136,232,114 M83L possibly damaging Het
Simc1 T C 13: 54,541,534 I284T probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
St6galnac1 A G 11: 116,769,107 S127P probably benign Het
Tatdn3 A G 1: 191,052,876 I192T possibly damaging Het
Tmem25 C A 9: 44,796,086 V239F possibly damaging Het
Tprkb A C 6: 85,932,940 probably benign Het
Trappc10 A G 10: 78,196,334 V1040A probably benign Het
Txnrd1 G A 10: 82,883,910 probably benign Het
Uhrf1 A T 17: 56,318,089 K544M probably damaging Het
Unc80 T A 1: 66,590,227 H1294Q possibly damaging Het
Uspl1 T A 5: 149,209,750 I437K probably damaging Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Vmn2r19 A T 6: 123,335,836 I622F probably damaging Het
Znfx1 A G 2: 167,055,810 F398S probably damaging Het
Other mutations in Cbfa2t3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Cbfa2t3 APN 8 122633493 missense probably damaging 1.00
IGL02578:Cbfa2t3 APN 8 122633448 missense possibly damaging 0.83
IGL02934:Cbfa2t3 APN 8 122647758 missense probably benign 0.03
IGL03089:Cbfa2t3 APN 8 122635134 missense probably damaging 1.00
R0196:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.77
R0365:Cbfa2t3 UTSW 8 122635060 missense probably benign 0.23
R0395:Cbfa2t3 UTSW 8 122638951 missense probably benign 0.09
R0784:Cbfa2t3 UTSW 8 122650487 splice site probably benign
R0835:Cbfa2t3 UTSW 8 122647778 missense probably benign 0.00
R1608:Cbfa2t3 UTSW 8 122647709 missense probably damaging 0.99
R2008:Cbfa2t3 UTSW 8 122643293 missense probably damaging 0.99
R2095:Cbfa2t3 UTSW 8 122634988 missense probably benign
R4079:Cbfa2t3 UTSW 8 122647695 splice site probably null
R4175:Cbfa2t3 UTSW 8 122643318 missense probably damaging 1.00
R5013:Cbfa2t3 UTSW 8 122638859 missense possibly damaging 0.95
R5141:Cbfa2t3 UTSW 8 122635021 missense probably benign 0.24
R5391:Cbfa2t3 UTSW 8 122633395 nonsense probably null
R6067:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6078:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
R6192:Cbfa2t3 UTSW 8 122634396 missense probably benign 0.00
R6281:Cbfa2t3 UTSW 8 122633409 missense probably damaging 1.00
R6520:Cbfa2t3 UTSW 8 122635801 missense probably benign 0.02
R6936:Cbfa2t3 UTSW 8 122647739 missense probably damaging 0.97
R7154:Cbfa2t3 UTSW 8 122638144 nonsense probably null
R7196:Cbfa2t3 UTSW 8 122638990 missense probably benign 0.26
R7295:Cbfa2t3 UTSW 8 122638029 missense probably benign 0.02
R7514:Cbfa2t3 UTSW 8 122635126 missense probably damaging 1.00
R7616:Cbfa2t3 UTSW 8 122633337 missense possibly damaging 0.87
R8070:Cbfa2t3 UTSW 8 122642981 missense possibly damaging 0.81
R8485:Cbfa2t3 UTSW 8 122630778 missense probably damaging 0.97
R8534:Cbfa2t3 UTSW 8 122638914 missense probably damaging 1.00
R9718:Cbfa2t3 UTSW 8 122638197 missense probably benign 0.25
U15987:Cbfa2t3 UTSW 8 122643497 missense probably benign 0.00
Z1176:Cbfa2t3 UTSW 8 122698895 start gained probably benign
Z1177:Cbfa2t3 UTSW 8 122630757 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCTCCACTAGAGCATAGG -3'
(R):5'- CTGAGGCTGATGTCCATTGG -3'

Sequencing Primer
(F):5'- GTCCTCCACTAGAGCATAGGTACAAG -3'
(R):5'- AGGCTGATGTCCATTGGTCACC -3'
Posted On 2014-09-18