Incidental Mutation 'R2088:Gli1'
ID231599
Institutional Source Beutler Lab
Gene Symbol Gli1
Ensembl Gene ENSMUSG00000025407
Gene NameGLI-Kruppel family member GLI1
SynonymsZfp-5, Zfp5
MMRRC Submission 040093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2088 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127329882-127341974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 127331500 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 628 (Y628S)
Ref Sequence ENSEMBL: ENSMUSP00000026474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026474] [ENSMUST00000069548] [ENSMUST00000219026] [ENSMUST00000219511]
Predicted Effect probably damaging
Transcript: ENSMUST00000026474
AA Change: Y628S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026474
Gene: ENSMUSG00000025407
AA Change: Y628S

DomainStartEndE-ValueType
low complexity region 222 237 N/A INTRINSIC
ZnF_C2H2 238 263 1.33e-1 SMART
ZnF_C2H2 271 298 5.72e-1 SMART
ZnF_C2H2 304 328 2.57e-3 SMART
ZnF_C2H2 334 359 1.92e-2 SMART
ZnF_C2H2 365 390 2.61e-4 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 540 562 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 850 873 N/A INTRINSIC
low complexity region 941 962 N/A INTRINSIC
low complexity region 985 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069548
SMART Domains Protein: ENSMUSP00000066455
Gene: ENSMUSG00000040345

DomainStartEndE-ValueType
PH 60 175 8.19e-10 SMART
RhoGAP 276 469 1.94e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218656
Predicted Effect probably benign
Transcript: ENSMUST00000219026
Predicted Effect probably benign
Transcript: ENSMUST00000219511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219808
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel family of zinc finger proteins. The encoded transcription factor is activated by the sonic hedgehog signal transduction cascade and regulates stem cell proliferation. The activity and nuclear localization of this protein is negatively regulated by p53 in an inhibitory loop. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a targeted null mutation are apparently normal, but homozygotes that are also heterozygous for a Gli2 knockout die soon after birth with multiple defects, while Gli2 knockout heterozygotes are normally viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik T C 9: 58,499,005 F66S probably damaging Het
Ankk1 T C 9: 49,421,965 probably benign Het
Ano5 T A 7: 51,587,706 N759K possibly damaging Het
Arhgef10 A G 8: 14,983,898 T1072A possibly damaging Het
BC107364 T C 3: 96,434,429 T93A unknown Het
Canx C T 11: 50,310,390 E97K possibly damaging Het
Casp8ap2 T C 4: 32,631,126 L62P probably damaging Het
Cbfa2t3 C T 8: 122,637,986 probably benign Het
Cmya5 A T 13: 93,092,812 S1923T probably damaging Het
Cntnap1 T A 11: 101,182,547 I618N probably damaging Het
Cox17 C G 16: 38,347,180 P27R probably damaging Het
Ctnna3 A G 10: 64,873,207 E675G probably damaging Het
Cul9 A G 17: 46,526,649 L990P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Fhdc1 T C 3: 84,474,726 probably benign Het
Fryl T A 5: 73,065,461 I1926F probably benign Het
Galnt4 A G 10: 99,109,184 D257G probably damaging Het
Gatm A G 2: 122,598,148 V344A probably benign Het
Gpr1 A T 1: 63,183,652 probably null Het
Gsdmc3 A C 15: 63,860,214 probably null Het
Hap1 T C 11: 100,356,002 T26A probably benign Het
Helz2 C T 2: 181,235,102 G1200S probably benign Het
Iqgap2 C T 13: 95,891,663 probably null Het
Itga3 T A 11: 95,052,494 I895F probably benign Het
Klhl33 A T 14: 50,892,773 C421* probably null Het
Klra2 T C 6: 131,242,826 T131A probably damaging Het
Krt14 T C 11: 100,204,123 E426G possibly damaging Het
Limd2 A G 11: 106,158,742 F107L probably damaging Het
Lipo4 A T 19: 33,500,069 N318K possibly damaging Het
Mab21l2 T G 3: 86,547,009 D228A probably damaging Het
Moxd2 G A 6: 40,884,967 H224Y probably damaging Het
Mpp4 T C 1: 59,123,465 Y521C possibly damaging Het
Msto1 C T 3: 88,910,990 A317T probably damaging Het
Mtmr4 T C 11: 87,610,967 S559P probably damaging Het
Muc4 T A 16: 32,756,409 H2094Q unknown Het
Ndufa11 C A 17: 56,717,922 T28K probably damaging Het
Olfr124 A G 17: 37,805,795 T217A probably benign Het
Olfr1289 G T 2: 111,484,278 A283S probably damaging Het
Orai2 C A 5: 136,150,756 R155L probably damaging Het
Pde4c A G 8: 70,749,356 D582G possibly damaging Het
Pde4dip T C 3: 97,754,433 E609G probably null Het
Prune2 A G 19: 17,119,745 D871G possibly damaging Het
Rbpms2 T A 9: 65,630,839 L4Q probably damaging Het
Rhbg T C 3: 88,247,458 Y213C probably damaging Het
Rplp0 T A 5: 115,562,503 N243K possibly damaging Het
Rtp4 A T 16: 23,613,213 H165L possibly damaging Het
Ryr2 C A 13: 11,662,229 M3245I probably benign Het
Sh2b2 T A 5: 136,232,114 M83L possibly damaging Het
Simc1 T C 13: 54,541,534 I284T probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
St6galnac1 A G 11: 116,769,107 S127P probably benign Het
Tatdn3 A G 1: 191,052,876 I192T possibly damaging Het
Tmem25 C A 9: 44,796,086 V239F possibly damaging Het
Tprkb A C 6: 85,932,940 probably benign Het
Trappc10 A G 10: 78,196,334 V1040A probably benign Het
Txnrd1 G A 10: 82,883,910 probably benign Het
Uhrf1 A T 17: 56,318,089 K544M probably damaging Het
Unc80 T A 1: 66,590,227 H1294Q possibly damaging Het
Uspl1 T A 5: 149,209,750 I437K probably damaging Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Vmn2r19 A T 6: 123,335,836 I622F probably damaging Het
Znfx1 A G 2: 167,055,810 F398S probably damaging Het
Other mutations in Gli1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Gli1 APN 10 127332478 missense probably damaging 1.00
IGL01824:Gli1 APN 10 127336527 missense probably benign 0.44
IGL02134:Gli1 APN 10 127336500 missense probably benign 0.00
IGL02508:Gli1 APN 10 127337092 missense probably benign 0.14
IGL02931:Gli1 APN 10 127332410 missense probably benign 0.00
R0099:Gli1 UTSW 10 127336006 missense probably damaging 1.00
R0590:Gli1 UTSW 10 127331563 missense possibly damaging 0.82
R0792:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1169:Gli1 UTSW 10 127338451 missense probably damaging 1.00
R1519:Gli1 UTSW 10 127334269 missense possibly damaging 0.93
R1522:Gli1 UTSW 10 127332577 missense probably damaging 0.99
R1550:Gli1 UTSW 10 127338516 missense probably damaging 1.00
R1592:Gli1 UTSW 10 127331329 missense probably damaging 0.97
R1879:Gli1 UTSW 10 127333737 missense probably damaging 1.00
R1892:Gli1 UTSW 10 127330106 missense possibly damaging 0.82
R1934:Gli1 UTSW 10 127331239 missense possibly damaging 0.65
R2049:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R2141:Gli1 UTSW 10 127336727 missense probably damaging 1.00
R3803:Gli1 UTSW 10 127338065 splice site probably benign
R3873:Gli1 UTSW 10 127331356 missense probably damaging 1.00
R3874:Gli1 UTSW 10 127330219 missense probably damaging 1.00
R3899:Gli1 UTSW 10 127336666 missense possibly damaging 0.64
R4703:Gli1 UTSW 10 127330855 missense possibly damaging 0.88
R5552:Gli1 UTSW 10 127330262 missense probably benign 0.00
R5686:Gli1 UTSW 10 127337436 missense probably benign 0.01
R5812:Gli1 UTSW 10 127337415 missense probably damaging 1.00
R6053:Gli1 UTSW 10 127334315 missense probably damaging 1.00
R7088:Gli1 UTSW 10 127335999 missense probably damaging 1.00
R7162:Gli1 UTSW 10 127332437 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAACATTTTCGGTGATGCTG -3'
(R):5'- TCTGCTTACACAGTCAGCC -3'

Sequencing Primer
(F):5'- GGGCTGTGGCGAATAGAC -3'
(R):5'- AGGTCCTCCCTGGCATC -3'
Posted On2014-09-18