Incidental Mutation 'R2088:Mtmr4'
ID 231602
Institutional Source Beutler Lab
Gene Symbol Mtmr4
Ensembl Gene ENSMUSG00000018401
Gene Name myotubularin related protein 4
Synonyms ZFYVE11, FYVE zinc finger phosphatase, ESTM44, FYVE-DSP2
MMRRC Submission 040093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R2088 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 87592162-87616302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 87610967 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 559 (S559P)
Ref Sequence ENSEMBL: ENSMUSP00000090478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000119628]
AlphaFold Q91XS1
Predicted Effect probably damaging
Transcript: ENSMUST00000092802
AA Change: S559P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401
AA Change: S559P

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103179
AA Change: S616P

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401
AA Change: S616P

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119628
AA Change: S616P

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401
AA Change: S616P

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Meta Mutation Damage Score 0.0858 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik T C 9: 58,499,005 F66S probably damaging Het
Ankk1 T C 9: 49,421,965 probably benign Het
Ano5 T A 7: 51,587,706 N759K possibly damaging Het
Arhgef10 A G 8: 14,983,898 T1072A possibly damaging Het
BC107364 T C 3: 96,434,429 T93A unknown Het
Canx C T 11: 50,310,390 E97K possibly damaging Het
Casp8ap2 T C 4: 32,631,126 L62P probably damaging Het
Cbfa2t3 C T 8: 122,637,986 probably benign Het
Cmya5 A T 13: 93,092,812 S1923T probably damaging Het
Cntnap1 T A 11: 101,182,547 I618N probably damaging Het
Cox17 C G 16: 38,347,180 P27R probably damaging Het
Ctnna3 A G 10: 64,873,207 E675G probably damaging Het
Cul9 A G 17: 46,526,649 L990P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Fhdc1 T C 3: 84,474,726 probably benign Het
Fryl T A 5: 73,065,461 I1926F probably benign Het
Galnt4 A G 10: 99,109,184 D257G probably damaging Het
Gatm A G 2: 122,598,148 V344A probably benign Het
Gli1 T G 10: 127,331,500 Y628S probably damaging Het
Gpr1 A T 1: 63,183,652 probably null Het
Gsdmc3 A C 15: 63,860,214 probably null Het
Hap1 T C 11: 100,356,002 T26A probably benign Het
Helz2 C T 2: 181,235,102 G1200S probably benign Het
Iqgap2 C T 13: 95,891,663 probably null Het
Itga3 T A 11: 95,052,494 I895F probably benign Het
Klhl33 A T 14: 50,892,773 C421* probably null Het
Klra2 T C 6: 131,242,826 T131A probably damaging Het
Krt14 T C 11: 100,204,123 E426G possibly damaging Het
Limd2 A G 11: 106,158,742 F107L probably damaging Het
Lipo4 A T 19: 33,500,069 N318K possibly damaging Het
Mab21l2 T G 3: 86,547,009 D228A probably damaging Het
Moxd2 G A 6: 40,884,967 H224Y probably damaging Het
Mpp4 T C 1: 59,123,465 Y521C possibly damaging Het
Msto1 C T 3: 88,910,990 A317T probably damaging Het
Muc4 T A 16: 32,756,409 H2094Q unknown Het
Ndufa11 C A 17: 56,717,922 T28K probably damaging Het
Olfr124 A G 17: 37,805,795 T217A probably benign Het
Olfr1289 G T 2: 111,484,278 A283S probably damaging Het
Orai2 C A 5: 136,150,756 R155L probably damaging Het
Pde4c A G 8: 70,749,356 D582G possibly damaging Het
Pde4dip T C 3: 97,754,433 E609G probably null Het
Prune2 A G 19: 17,119,745 D871G possibly damaging Het
Rbpms2 T A 9: 65,630,839 L4Q probably damaging Het
Rhbg T C 3: 88,247,458 Y213C probably damaging Het
Rplp0 T A 5: 115,562,503 N243K possibly damaging Het
Rtp4 A T 16: 23,613,213 H165L possibly damaging Het
Ryr2 C A 13: 11,662,229 M3245I probably benign Het
Sh2b2 T A 5: 136,232,114 M83L possibly damaging Het
Simc1 T C 13: 54,541,534 I284T probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
St6galnac1 A G 11: 116,769,107 S127P probably benign Het
Tatdn3 A G 1: 191,052,876 I192T possibly damaging Het
Tmem25 C A 9: 44,796,086 V239F possibly damaging Het
Tprkb A C 6: 85,932,940 probably benign Het
Trappc10 A G 10: 78,196,334 V1040A probably benign Het
Txnrd1 G A 10: 82,883,910 probably benign Het
Uhrf1 A T 17: 56,318,089 K544M probably damaging Het
Unc80 T A 1: 66,590,227 H1294Q possibly damaging Het
Uspl1 T A 5: 149,209,750 I437K probably damaging Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Vmn2r19 A T 6: 123,335,836 I622F probably damaging Het
Znfx1 A G 2: 167,055,810 F398S probably damaging Het
Other mutations in Mtmr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Mtmr4 APN 11 87611924 missense probably benign 0.29
IGL01134:Mtmr4 APN 11 87604067 missense probably damaging 1.00
IGL01317:Mtmr4 APN 11 87602404 unclassified probably benign
IGL01544:Mtmr4 APN 11 87597611 splice site probably benign
IGL01574:Mtmr4 APN 11 87600647 missense probably benign 0.01
IGL01807:Mtmr4 APN 11 87604150 missense possibly damaging 0.55
IGL02059:Mtmr4 APN 11 87601124 missense possibly damaging 0.66
IGL03049:Mtmr4 APN 11 87614234 missense probably damaging 1.00
IGL03196:Mtmr4 APN 11 87600783 missense possibly damaging 0.92
IGL03214:Mtmr4 APN 11 87597693 missense probably damaging 1.00
IGL03258:Mtmr4 APN 11 87612003 missense possibly damaging 0.63
Hippie UTSW 11 87613483 missense probably damaging 1.00
incharge UTSW 11 87611042 nonsense probably null
PIT4802001:Mtmr4 UTSW 11 87611127 missense probably benign
R0009:Mtmr4 UTSW 11 87611508 missense probably benign 0.02
R0564:Mtmr4 UTSW 11 87598888 missense probably damaging 1.00
R0637:Mtmr4 UTSW 11 87611064 missense probably benign 0.30
R0780:Mtmr4 UTSW 11 87611440 missense probably benign 0.03
R1490:Mtmr4 UTSW 11 87612225 missense probably damaging 1.00
R1550:Mtmr4 UTSW 11 87613516 missense probably damaging 1.00
R1777:Mtmr4 UTSW 11 87602830 missense probably damaging 1.00
R1828:Mtmr4 UTSW 11 87612117 missense probably benign 0.26
R2040:Mtmr4 UTSW 11 87605090 missense probably damaging 1.00
R2497:Mtmr4 UTSW 11 87600823 missense probably damaging 1.00
R2993:Mtmr4 UTSW 11 87604997 missense probably damaging 1.00
R3857:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R3858:Mtmr4 UTSW 11 87597262 missense probably damaging 0.98
R4614:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4615:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4616:Mtmr4 UTSW 11 87610935 missense probably damaging 0.99
R4816:Mtmr4 UTSW 11 87604097 missense probably damaging 1.00
R5454:Mtmr4 UTSW 11 87611042 nonsense probably null
R5502:Mtmr4 UTSW 11 87614078 missense probably damaging 1.00
R5566:Mtmr4 UTSW 11 87604530 missense probably damaging 1.00
R5833:Mtmr4 UTSW 11 87605049 nonsense probably null
R5907:Mtmr4 UTSW 11 87612050 missense probably damaging 0.99
R5980:Mtmr4 UTSW 11 87604151 missense probably damaging 1.00
R6077:Mtmr4 UTSW 11 87611019 missense probably damaging 1.00
R6434:Mtmr4 UTSW 11 87613483 missense probably damaging 1.00
R6521:Mtmr4 UTSW 11 87613527 missense possibly damaging 0.86
R7141:Mtmr4 UTSW 11 87600613 missense probably damaging 1.00
R7182:Mtmr4 UTSW 11 87604605 critical splice donor site probably null
R7290:Mtmr4 UTSW 11 87611237 missense probably benign
R7350:Mtmr4 UTSW 11 87600650 missense probably damaging 0.98
R7392:Mtmr4 UTSW 11 87604557 missense probably damaging 1.00
R7447:Mtmr4 UTSW 11 87611901 missense probably damaging 1.00
R7530:Mtmr4 UTSW 11 87611876 missense probably damaging 1.00
R7660:Mtmr4 UTSW 11 87604580 missense probably damaging 0.99
R7713:Mtmr4 UTSW 11 87597724 missense probably damaging 1.00
R7823:Mtmr4 UTSW 11 87612189 missense probably damaging 1.00
R7944:Mtmr4 UTSW 11 87604428 missense probably damaging 1.00
R7945:Mtmr4 UTSW 11 87604428 missense probably damaging 1.00
R8010:Mtmr4 UTSW 11 87598864 missense probably damaging 1.00
R8116:Mtmr4 UTSW 11 87611930 nonsense probably null
R8544:Mtmr4 UTSW 11 87611909 missense possibly damaging 0.86
R8559:Mtmr4 UTSW 11 87604124 missense probably damaging 1.00
R8971:Mtmr4 UTSW 11 87602800 missense probably benign 0.13
R9562:Mtmr4 UTSW 11 87602415 missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87612312 missense probably damaging 1.00
R9673:Mtmr4 UTSW 11 87614090 missense probably damaging 1.00
R9797:Mtmr4 UTSW 11 87604136 missense probably damaging 1.00
X0062:Mtmr4 UTSW 11 87611825 missense probably damaging 0.99
Z1177:Mtmr4 UTSW 11 87611880 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ATCCTTTGTGCAGAGTAGACTC -3'
(R):5'- GTACTCTTTCTGGCTACTGGGC -3'

Sequencing Primer
(F):5'- AGAGTAGACTCCCGGTGAACTTC -3'
(R):5'- AGGAGGAAGGCCCATTTCTC -3'
Posted On 2014-09-18