Mutagenetix > Incidental Mutation

Incidental Mutation 'R2089:Pik3cd'

231644

Institutional Source

Beutler Lab

Gene Symbol

Pik3cd

Ensembl Gene

ENSMUSG00000039936

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta

Synonyms

2410099E07Rik, p110delta, 2610208K16Rik

MMRRC Submission

040094-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R2089 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

149649168-149702571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 149652699 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 880 (L880P)

Ref Sequence

ENSEMBL: ENSMUSP00000136045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038859] [ENSMUST00000039144] [ENSMUST00000105688] [ENSMUST00000105689] [ENSMUST00000105690] [ENSMUST00000105691] [ENSMUST00000118704] [ENSMUST00000122059] [ENSMUST00000177654]

AlphaFold

O35904

Predicted Effect

probably damaging
Transcript: ENSMUST00000038859
AA Change: L878P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036434
Gene: ENSMUSG00000039936
AA Change: L878P

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	685	8.56e-87	SMART
PI3Kc	776	1042	5.65e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000039144

SMART Domains

Protein: ENSMUSP00000036962
Gene: ENSMUSG00000039953

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	162	1.25e-11	SMART
CA	185	263	1.03e-3	SMART
Pfam:Laminin_G_3	365	510	3.3e-9	PFAM
low complexity region	663	674	N/A	INTRINSIC
transmembrane domain	860	882	N/A	INTRINSIC
coiled coil region	915	949	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105688
AA Change: L877P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101313
Gene: ENSMUSG00000039936
AA Change: L877P

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	685	8.56e-87	SMART
PI3Kc	775	1041	5.65e-128	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105689
AA Change: L876P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101314
Gene: ENSMUSG00000039936
AA Change: L876P

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	684	1.35e-84	SMART
PI3Kc	774	1040	5.65e-128	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105690
AA Change: L880P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101315
Gene: ENSMUSG00000039936
AA Change: L880P

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	688	1.22e-82	SMART
PI3Kc	778	1044	5.65e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105691

SMART Domains

Protein: ENSMUSP00000101316
Gene: ENSMUSG00000039953

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
CA	59	152	2.91e-12	SMART
CA	175	253	1.03e-3	SMART
Pfam:Laminin_G_3	350	544	1.1e-12	PFAM
low complexity region	653	664	N/A	INTRINSIC
transmembrane domain	850	872	N/A	INTRINSIC
coiled coil region	905	939	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118704
AA Change: L879P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112863
Gene: ENSMUSG00000039936
AA Change: L879P

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	687	1.8e-80	SMART
PI3Kc	777	1043	5.65e-128	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122059
AA Change: L873P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113844
Gene: ENSMUSG00000039936
AA Change: L873P

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	408	6.47e-23	SMART
PI3Ka	492	681	8.56e-87	SMART
PI3Kc	771	1037	5.65e-128	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000177654
AA Change: L880P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136045
Gene: ENSMUSG00000039936
AA Change: L880P

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	2.24e-26	SMART
PI3K_rbd	174	281	1.3e-13	SMART
PI3K_C2	309	412	1.87e-28	SMART
PI3Ka	496	688	1.22e-82	SMART
PI3Kc	778	1044	5.65e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185093

Meta Mutation Damage Score

0.9682

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired B and T cell antigen receptor signaling, reduced or ablated immune responses and decreased immunoglobulin levels. Mutants also develop inflammatory bowel disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	G	C	2: 19,517,546	N247K	probably damaging	Het
4930402F06Rik	T	C	2: 35,376,067	K197R	probably benign	Het
4932438A13Rik	C	T	3: 36,988,256	T2797I	probably damaging	Het
Adgrl1	T	C	8: 83,934,464	I862T	probably damaging	Het
Agbl1	G	A	7: 76,589,500	V583M	probably damaging	Het
Apba2	T	A	7: 64,695,593	V177D	probably benign	Het
Atg14	A	T	14: 47,542,895	I474N	probably damaging	Het
Bicdl1	A	G	5: 115,724,579	S206P	probably damaging	Het
Calhm3	T	A	19: 47,151,991	D221V	probably damaging	Het
Ccdc93	T	A	1: 121,483,342		probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dido1	A	T	2: 180,661,884	V1409E	probably benign	Het
Dsc2	G	A	18: 20,033,294	T760I	possibly damaging	Het
Etnk2	T	G	1: 133,377,053		probably null	Het
Gbp7	A	T	3: 142,534,622	I34F	probably damaging	Het
Gbp7	A	T	3: 142,545,555		probably benign	Het
Gpr37	A	G	6: 25,689,063	S12P	possibly damaging	Het
Grxcr1	T	C	5: 68,110,412	I168T	probably damaging	Het
Hat1	T	C	2: 71,434,034	V272A	probably benign	Het
Igkv8-30	A	C	6: 70,117,086	C114G	probably damaging	Het
Lrrc4	T	G	6: 28,830,587	D343A	probably benign	Het
Mars	A	G	10: 127,299,285	S646P	probably damaging	Het
Micu3	G	A	8: 40,308,372	G108R	probably benign	Het
Mterf1b	A	T	5: 4,197,057	T233S	possibly damaging	Het
Myrf	A	T	19: 10,224,600	V171D	possibly damaging	Het
Nbas	G	A	12: 13,361,045	D897N	probably benign	Het
Nfx1	T	C	4: 40,977,004	V226A	probably benign	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Ntrk2	A	G	13: 58,859,301	H239R	possibly damaging	Het
Olfr979	T	C	9: 40,001,204	T8A	probably benign	Het
Pcdhb18	T	C	18: 37,490,600	S328P	probably damaging	Het
Pigm	T	C	1: 172,377,533	Y279H	probably damaging	Het
Pla2g16	A	G	19: 7,579,109	I92V	probably damaging	Het
Ptger4	T	A	15: 5,242,845	I98F	possibly damaging	Het
Rasl11a	T	A	5: 146,847,117	I124N	probably damaging	Het
Rest	A	G	5: 77,281,279	K515R	possibly damaging	Het
Ryr1	A	G	7: 29,086,049	L1746P	probably damaging	Het
Ryr2	G	T	13: 11,945,977	T25K	probably benign	Het
Serpina3g	A	T	12: 104,239,158	D52V	probably damaging	Het
Skint6	T	C	4: 112,846,684	N998S	probably benign	Het
Sntg1	T	A	1: 8,595,539	T184S	probably benign	Het
Ssbp1	A	G	6: 40,476,499	Y73C	probably null	Het
Suclg1	A	G	6: 73,264,276	K193R	probably benign	Het
Tnrc18	A	C	5: 142,773,641	S813R	unknown	Het
Tnrc6a	T	C	7: 123,172,120		probably null	Het
Trap1	A	C	16: 4,046,039	Y472*	probably null	Het
Trpm8	T	C	1: 88,343,326	I446T	probably damaging	Het
Tti2	T	C	8: 31,154,266	L297P	probably damaging	Het
Umodl1	A	G	17: 30,971,919	M247V	probably benign	Het
Unc80	T	A	1: 66,671,715		probably benign	Het
Zfp174	A	G	16: 3,854,642	R352G	possibly damaging	Het

Other mutations in Pik3cd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Pik3cd	APN	4	149657460	missense	probably damaging	1.00
IGL01536:Pik3cd	APN	4	149652666	missense	probably damaging	1.00
IGL01636:Pik3cd	APN	4	149654315	missense	possibly damaging	0.82
IGL02794:Pik3cd	APN	4	149654571	missense	probably benign
grand_tetons	UTSW	4	149652699	missense	probably damaging	1.00
Helena	UTSW	4	149651820	missense	probably damaging	1.00
stinger	UTSW	4	149657319	missense	probably damaging	1.00
F5770:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
R0003:Pik3cd	UTSW	4	149656379	critical splice donor site	probably null
R0309:Pik3cd	UTSW	4	149663220	missense	probably damaging	1.00
R1246:Pik3cd	UTSW	4	149659800	missense	probably damaging	1.00
R1259:Pik3cd	UTSW	4	149650648	nonsense	probably null
R1533:Pik3cd	UTSW	4	149655196	missense	probably damaging	1.00
R1756:Pik3cd	UTSW	4	149658750	missense	probably benign	0.02
R1796:Pik3cd	UTSW	4	149654119	missense	possibly damaging	0.83
R1887:Pik3cd	UTSW	4	149652634	missense	probably damaging	1.00
R1988:Pik3cd	UTSW	4	149663203	missense	probably damaging	1.00
R2091:Pik3cd	UTSW	4	149652699	missense	probably damaging	1.00
R4997:Pik3cd	UTSW	4	149658984	missense	probably damaging	1.00
R5391:Pik3cd	UTSW	4	149659131	missense	probably damaging	0.98
R5603:Pik3cd	UTSW	4	149658855	missense	probably benign
R6282:Pik3cd	UTSW	4	149659743	missense	probably benign	0.00
R6453:Pik3cd	UTSW	4	149652302	missense	probably damaging	1.00
R7286:Pik3cd	UTSW	4	149659714	missense	probably benign	0.08
R7423:Pik3cd	UTSW	4	149651763	critical splice donor site	probably null
R7508:Pik3cd	UTSW	4	149654583	missense	possibly damaging	0.78
R7665:Pik3cd	UTSW	4	149654050	missense	possibly damaging	0.70
R7897:Pik3cd	UTSW	4	149657269	missense	probably benign	0.06
R8039:Pik3cd	UTSW	4	149659866	missense	possibly damaging	0.91
R8476:Pik3cd	UTSW	4	149651820	missense	probably damaging	1.00
R9015:Pik3cd	UTSW	4	149655598	missense	probably benign	0.06
R9252:Pik3cd	UTSW	4	149655630	missense	possibly damaging	0.88
R9704:Pik3cd	UTSW	4	149655382	missense	probably benign	0.17
V7580:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
V7581:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
V7582:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
V7583:Pik3cd	UTSW	4	149657319	missense	probably damaging	1.00
X0023:Pik3cd	UTSW	4	149660034	missense	probably benign	0.04
Z1176:Pik3cd	UTSW	4	149654847	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCATGCCCCTTGAGAGAC -3'
(R):5'- TTTTAGGCCTAAGCTCTGGGAC -3'

Sequencing Primer
(F):5'- AGGGCTCACAGCGTTCTC -3'
(R):5'- GGCCTAAGCTCTGGGACTATATAC -3'

Posted On

2014-09-18