Incidental Mutation 'R0190:Zfp422'
ID23166
Institutional Source Beutler Lab
Gene Symbol Zfp422
Ensembl Gene ENSMUSG00000059878
Gene Namezinc finger protein 422
SynonymsKrox26, 2900028O21Rik, Krox-26, Krox25, KOX15, Krox-25-2
MMRRC Submission 038451-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0190 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location116624016-116628999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116626611 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 142 (D142E)
Ref Sequence ENSEMBL: ENSMUSP00000108501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057540] [ENSMUST00000079749] [ENSMUST00000112880]
Predicted Effect probably damaging
Transcript: ENSMUST00000057540
AA Change: D142E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084926
Gene: ENSMUSG00000059878
AA Change: D142E

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079749
AA Change: D142E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078685
Gene: ENSMUSG00000059878
AA Change: D142E

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112880
AA Change: D142E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108501
Gene: ENSMUSG00000059878
AA Change: D142E

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204559
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 91.6%
  • 20x: 72.5%
Validation Efficiency 75% (45/60)
MGI Phenotype FUNCTION: This gene encodes a putative C2H2 zinc finger transcription factor that may play a role in tooth development. A pseudogene related to this gene is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,392 probably null Het
Aff2 CA CAAA X: 69,849,105 probably null Het
Ankrd34a A G 3: 96,597,789 D103G probably damaging Het
Atp1b2 T C 11: 69,601,562 D224G probably damaging Het
Atxn10 A G 15: 85,336,529 D22G possibly damaging Het
B230118H07Rik G A 2: 101,586,430 S58L probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Caskin1 C T 17: 24,504,622 L795F possibly damaging Het
Cdk12 T C 11: 98,241,831 probably null Het
Crtc2 A G 3: 90,259,409 H91R probably damaging Het
Dbt A G 3: 116,539,087 probably null Het
Dda1 C A 8: 71,472,233 Y41* probably null Het
Dnah2 T A 11: 69,435,249 D3692V probably damaging Het
Dpep1 A G 8: 123,200,708 T334A probably benign Het
Enthd1 C T 15: 80,534,494 probably null Het
Fpr-rs6 T A 17: 20,182,479 I207F probably benign Het
Fsip2 T A 2: 82,985,177 S3751R possibly damaging Het
Gigyf2 A T 1: 87,428,688 probably benign Het
Gtf3c4 C A 2: 28,840,128 D34Y probably benign Het
Igfn1 A T 1: 135,962,052 V2419E probably damaging Het
Kank1 A T 19: 25,409,283 I79L probably benign Het
Kif21b A G 1: 136,171,219 H1415R probably benign Het
Mad2l1 T C 6: 66,539,878 S185P possibly damaging Het
Mettl18 A G 1: 163,996,422 E104G probably damaging Het
Mrgprb2 G A 7: 48,552,777 H67Y possibly damaging Het
Mrgprd G A 7: 145,321,702 M103I probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Nucks1 A G 1: 131,924,591 D60G probably damaging Het
Olfr1245 T A 2: 89,574,958 Y256F probably damaging Het
Olfr275 G C 4: 52,825,613 W72S probably damaging Het
Olfr978 A G 9: 39,994,544 I245V probably benign Het
Paqr8 A G 1: 20,935,047 T142A probably benign Het
Pdss1 T C 2: 22,906,831 S119P probably damaging Het
Plcl2 A G 17: 50,607,643 D560G probably benign Het
Ppm1b T A 17: 84,994,103 V137E probably damaging Het
Ppp1r16b A C 2: 158,696,063 K35Q probably damaging Het
Prkd2 A T 7: 16,869,890 E832V probably damaging Het
Rab34 G T 11: 78,191,406 K191N possibly damaging Het
Rad51ap2 A C 12: 11,458,539 T821P probably benign Het
Rbm19 A G 5: 120,144,046 T823A probably benign Het
Rpf2 T G 10: 40,227,601 H106P probably damaging Het
Schip1 A G 3: 68,625,844 M453V probably benign Het
Sema5a T A 15: 32,562,774 N310K possibly damaging Het
Sf3b1 T C 1: 54,990,306 D1179G probably damaging Het
Skint2 A T 4: 112,616,532 T4S possibly damaging Het
Slc22a5 A T 11: 53,869,415 Y358* probably null Het
Slc34a1 T C 13: 55,409,101 M251T probably benign Het
Slc44a5 A G 3: 154,239,118 D124G probably null Het
Slc9b1 G A 3: 135,357,673 E73K unknown Het
Ssbp2 T C 13: 91,669,710 L156P probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Trim47 A G 11: 116,106,227 V568A probably damaging Het
Ttn A T 2: 76,887,980 probably benign Het
Ttpa A T 4: 20,021,260 I74F probably damaging Het
Vmn2r52 T C 7: 10,171,388 I175V probably benign Het
Wrn C T 8: 33,240,983 C1350Y probably benign Het
Zfp11 C T 5: 129,658,238 G53E possibly damaging Het
Zfp473 A T 7: 44,733,188 C574S probably damaging Het
Zfp638 T A 6: 83,928,964 M37K probably damaging Het
Zfp976 C A 7: 42,642,524 probably benign Het
Other mutations in Zfp422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp422 APN 6 116626958 missense probably benign 0.00
IGL00659:Zfp422 APN 6 116626505 nonsense probably null
IGL03199:Zfp422 APN 6 116626951 missense probably benign 0.43
R1572:Zfp422 UTSW 6 116626784 missense probably damaging 1.00
R1756:Zfp422 UTSW 6 116626424 missense probably benign 0.00
R2290:Zfp422 UTSW 6 116626642 missense possibly damaging 0.74
R3724:Zfp422 UTSW 6 116626379 missense probably benign 0.00
R3932:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R3933:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R4700:Zfp422 UTSW 6 116626883 missense possibly damaging 0.59
R4806:Zfp422 UTSW 6 116626662 missense probably damaging 1.00
R4957:Zfp422 UTSW 6 116626943 nonsense probably null
R5784:Zfp422 UTSW 6 116626810 missense probably damaging 1.00
R6361:Zfp422 UTSW 6 116626820 missense probably damaging 1.00
R8303:Zfp422 UTSW 6 116626651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCGCACTGTCATGAAACTCC -3'
(R):5'- ACGCTCTTTCAGCACAAGAAGATCC -3'

Sequencing Primer
(F):5'- AGTGCTCTACTGTAAAGCATCC -3'
(R):5'- TTTCAGCACAAGAAGATCCATACTG -3'
Posted On2013-04-16