Incidental Mutation 'R2089:Serpina3g'
ID231667
Institutional Source Beutler Lab
Gene Symbol Serpina3g
Ensembl Gene ENSMUSG00000041481
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3G
SynonymsSpi2-1, 2A2, Spi2A, Spi2/eb.1, alpha-1 antiproteinase,, alpha-1 antiproteinase
MMRRC Submission 040094-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2089 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104236245-104241939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104239158 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 52 (D52V)
Ref Sequence ENSEMBL: ENSMUSP00000129633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043315] [ENSMUST00000170628] [ENSMUST00000171916]
Predicted Effect probably damaging
Transcript: ENSMUST00000043315
AA Change: D52V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041250
Gene: ENSMUSG00000041481
AA Change: D52V

DomainStartEndE-ValueType
SERPIN 1 215 1.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171065
Predicted Effect probably damaging
Transcript: ENSMUST00000171916
AA Change: D52V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129633
Gene: ENSMUSG00000041481
AA Change: D52V

DomainStartEndE-ValueType
Pfam:Serpin 1 101 1.3e-31 PFAM
Meta Mutation Damage Score 0.9195 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired memory T cell homeostatic proliferation, decreased CD8+ T cells and antigen-specific CD8+ T cells after LCMV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Calhm3 T A 19: 47,151,991 D221V probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Etnk2 T G 1: 133,377,053 probably null Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gbp7 A T 3: 142,545,555 probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Micu3 G A 8: 40,308,372 G108R probably benign Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pik3cd A G 4: 149,652,699 L880P probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Unc80 T A 1: 66,671,715 probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Other mutations in Serpina3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Serpina3g APN 12 104241178 missense probably damaging 0.99
IGL02663:Serpina3g APN 12 104239140 missense possibly damaging 0.94
R0047:Serpina3g UTSW 12 104240284 missense possibly damaging 0.69
R0525:Serpina3g UTSW 12 104238339 missense probably damaging 1.00
R0702:Serpina3g UTSW 12 104241253 missense probably damaging 0.96
R1163:Serpina3g UTSW 12 104239292 missense possibly damaging 0.84
R1595:Serpina3g UTSW 12 104239272 missense probably benign 0.16
R1908:Serpina3g UTSW 12 104241277 missense probably damaging 0.96
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2403:Serpina3g UTSW 12 104241162 missense probably damaging 1.00
R4165:Serpina3g UTSW 12 104240287 missense probably benign 0.00
R4466:Serpina3g UTSW 12 104237923 splice site probably benign
R4669:Serpina3g UTSW 12 104239220 missense probably damaging 1.00
R4735:Serpina3g UTSW 12 104239113 missense probably damaging 1.00
R5423:Serpina3g UTSW 12 104237994 utr 5 prime probably benign
R5552:Serpina3g UTSW 12 104240336 missense probably damaging 0.96
R5605:Serpina3g UTSW 12 104241040 missense probably damaging 1.00
R6384:Serpina3g UTSW 12 104240396 missense probably null 0.34
R6446:Serpina3g UTSW 12 104239082 missense probably damaging 1.00
R7100:Serpina3g UTSW 12 104238311 start gained probably benign
R7869:Serpina3g UTSW 12 104240251 missense probably benign 0.05
R7878:Serpina3g UTSW 12 104238102 start gained probably benign
R7952:Serpina3g UTSW 12 104240251 missense probably benign 0.05
R7961:Serpina3g UTSW 12 104238102 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTTGCAGTCTCTGTGCCAG -3'
(R):5'- GAGTTACTGGGCTACTAGACATCAG -3'

Sequencing Primer
(F):5'- CTGTGCCAGTGTTACAATCTG -3'
(R):5'- AACAGCACTACGGGGATCCTTG -3'
Posted On2014-09-18