Incidental Mutation 'R2090:Man2a2'
ID231705
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Namemannosidase 2, alpha 2
Synonymsalpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission 040095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R2090 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80349097-80371375 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 80364110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206301] [ENSMUST00000206807]
Predicted Effect probably benign
Transcript: ENSMUST00000098346
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205535
Predicted Effect probably benign
Transcript: ENSMUST00000205853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206066
Predicted Effect probably benign
Transcript: ENSMUST00000206301
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206973
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,676 S283P probably benign Het
Adam32 A G 8: 24,901,440 probably null Het
Adcy7 A T 8: 88,315,857 T451S probably damaging Het
Adgrg3 A T 8: 95,039,930 T410S possibly damaging Het
Alg11 G T 8: 22,065,630 L302F possibly damaging Het
Ankrd17 A G 5: 90,298,046 V310A possibly damaging Het
Atg16l2 C T 7: 101,293,368 probably null Het
AY761184 A T 8: 21,702,789 W64R possibly damaging Het
B3gnt2 A G 11: 22,836,291 V299A probably benign Het
Birc6 A G 17: 74,662,796 N4258S probably benign Het
C2cd4d A G 3: 94,364,014 K196E probably benign Het
Cdr2l A G 11: 115,391,001 K111E probably damaging Het
Crtam T C 9: 40,984,316 Q41R possibly damaging Het
Cspp1 A G 1: 10,090,268 K560R possibly damaging Het
Dcaf15 A T 8: 84,097,771 Y571* probably null Het
Dpy19l4 T C 4: 11,304,344 Y99C probably benign Het
Edem3 C T 1: 151,804,826 probably benign Het
Enpp6 A T 8: 47,065,370 probably null Het
Fam26f A G 10: 34,126,362 S242P probably damaging Het
Foxf2 T A 13: 31,626,841 D254E probably benign Het
Gjb5 T C 4: 127,356,001 N117D probably benign Het
Glmn G A 5: 107,561,928 L337F probably damaging Het
Gsdmc2 T A 15: 63,826,826 Y307F probably benign Het
Gsdmc3 T A 15: 63,866,782 M144L probably benign Het
Ibtk A G 9: 85,720,993 I653T probably benign Het
Il24 T G 1: 130,884,837 D99A possibly damaging Het
Intu A G 3: 40,683,536 Q484R probably benign Het
Lsp1 T C 7: 142,491,807 probably benign Het
Mad1l1 A G 5: 140,009,256 S672P probably benign Het
Morc3 C A 16: 93,866,453 H515N probably benign Het
Nav1 T C 1: 135,607,165 probably benign Het
Ndor1 A G 2: 25,249,218 L247P probably damaging Het
Nfkbiz A T 16: 55,816,455 F494L probably benign Het
Nr1d1 G A 11: 98,770,610 P277S probably damaging Het
Nrg2 T C 18: 36,018,443 D682G probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Oasl1 G A 5: 114,935,934 D301N probably damaging Het
Olfr1118 A T 2: 87,309,418 I230F probably benign Het
Olfr196 A G 16: 59,168,140 M1T probably null Het
Olfr304 A T 7: 86,386,081 I193N probably benign Het
Palmd A G 3: 116,927,434 S123P probably damaging Het
Patj A G 4: 98,437,323 probably benign Het
Pcsk4 T C 10: 80,325,821 D162G probably benign Het
Plppr5 A G 3: 117,575,871 D59G possibly damaging Het
Pmvk A C 3: 89,461,882 R11S possibly damaging Het
Pnliprp1 A G 19: 58,740,469 T363A probably benign Het
Poll A T 19: 45,558,838 I65N probably benign Het
Prox1 T A 1: 190,160,812 S479C probably damaging Het
Prss50 A T 9: 110,862,293 S222C probably damaging Het
Rasa3 A C 8: 13,582,381 probably benign Het
Sec14l3 T C 11: 4,075,481 V335A probably benign Het
Setbp1 C T 18: 78,856,720 S1244N probably benign Het
Sgcg A T 14: 61,245,764 F63I probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc2a13 T A 15: 91,516,492 I176F probably benign Het
Smc6 A G 12: 11,289,986 T432A probably benign Het
Snx25 G A 8: 46,056,113 P478L probably damaging Het
Taf2 A T 15: 55,016,486 H1151Q probably damaging Het
Thsd1 A G 8: 22,259,657 K795R possibly damaging Het
Tmem108 G A 9: 103,484,777 L537F possibly damaging Het
Ubr3 T C 2: 69,936,017 Y410H probably damaging Het
Vav3 T C 3: 109,647,739 probably null Het
Vmn1r224 T C 17: 20,419,262 Y34H probably benign Het
Zeb1 T C 18: 5,766,458 V323A possibly damaging Het
Zfp652 A G 11: 95,754,008 D240G probably benign Het
Zfp963 A T 8: 69,743,346 C152* probably null Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGGCTTGCTGTTGAGG -3'
(R):5'- TGTGCGAACCCACATTTGC -3'

Sequencing Primer
(F):5'- TTGAGGAAGTCAAAGAGCCGC -3'
(R):5'- AGTTCCTCAGTTGAAGCCAG -3'
Posted On2014-09-18