Incidental Mutation 'R2090:Olfr304'
ID231706
Institutional Source Beutler Lab
Gene Symbol Olfr304
Ensembl Gene ENSMUSG00000062426
Gene Nameolfactory receptor 304
SynonymsGA_x6K02T2NHDJ-9721756-9722757, MOR219-3P
MMRRC Submission 040095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2090 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86385657-86386658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86386081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 193 (I193N)
Ref Sequence ENSEMBL: ENSMUSP00000076449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077210]
Predicted Effect probably benign
Transcript: ENSMUST00000077210
AA Change: I193N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000076449
Gene: ENSMUSG00000062426
AA Change: I193N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 8.9e-38 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,676 S283P probably benign Het
Adam32 A G 8: 24,901,440 probably null Het
Adcy7 A T 8: 88,315,857 T451S probably damaging Het
Adgrg3 A T 8: 95,039,930 T410S possibly damaging Het
Alg11 G T 8: 22,065,630 L302F possibly damaging Het
Ankrd17 A G 5: 90,298,046 V310A possibly damaging Het
Atg16l2 C T 7: 101,293,368 probably null Het
AY761184 A T 8: 21,702,789 W64R possibly damaging Het
B3gnt2 A G 11: 22,836,291 V299A probably benign Het
Birc6 A G 17: 74,662,796 N4258S probably benign Het
C2cd4d A G 3: 94,364,014 K196E probably benign Het
Cdr2l A G 11: 115,391,001 K111E probably damaging Het
Crtam T C 9: 40,984,316 Q41R possibly damaging Het
Cspp1 A G 1: 10,090,268 K560R possibly damaging Het
Dcaf15 A T 8: 84,097,771 Y571* probably null Het
Dpy19l4 T C 4: 11,304,344 Y99C probably benign Het
Edem3 C T 1: 151,804,826 probably benign Het
Enpp6 A T 8: 47,065,370 probably null Het
Fam26f A G 10: 34,126,362 S242P probably damaging Het
Foxf2 T A 13: 31,626,841 D254E probably benign Het
Gjb5 T C 4: 127,356,001 N117D probably benign Het
Glmn G A 5: 107,561,928 L337F probably damaging Het
Gsdmc2 T A 15: 63,826,826 Y307F probably benign Het
Gsdmc3 T A 15: 63,866,782 M144L probably benign Het
Ibtk A G 9: 85,720,993 I653T probably benign Het
Il24 T G 1: 130,884,837 D99A possibly damaging Het
Intu A G 3: 40,683,536 Q484R probably benign Het
Lsp1 T C 7: 142,491,807 probably benign Het
Mad1l1 A G 5: 140,009,256 S672P probably benign Het
Man2a2 A T 7: 80,364,110 probably benign Het
Morc3 C A 16: 93,866,453 H515N probably benign Het
Nav1 T C 1: 135,607,165 probably benign Het
Ndor1 A G 2: 25,249,218 L247P probably damaging Het
Nfkbiz A T 16: 55,816,455 F494L probably benign Het
Nr1d1 G A 11: 98,770,610 P277S probably damaging Het
Nrg2 T C 18: 36,018,443 D682G probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Oasl1 G A 5: 114,935,934 D301N probably damaging Het
Olfr1118 A T 2: 87,309,418 I230F probably benign Het
Olfr196 A G 16: 59,168,140 M1T probably null Het
Palmd A G 3: 116,927,434 S123P probably damaging Het
Patj A G 4: 98,437,323 probably benign Het
Pcsk4 T C 10: 80,325,821 D162G probably benign Het
Plppr5 A G 3: 117,575,871 D59G possibly damaging Het
Pmvk A C 3: 89,461,882 R11S possibly damaging Het
Pnliprp1 A G 19: 58,740,469 T363A probably benign Het
Poll A T 19: 45,558,838 I65N probably benign Het
Prox1 T A 1: 190,160,812 S479C probably damaging Het
Prss50 A T 9: 110,862,293 S222C probably damaging Het
Rasa3 A C 8: 13,582,381 probably benign Het
Sec14l3 T C 11: 4,075,481 V335A probably benign Het
Setbp1 C T 18: 78,856,720 S1244N probably benign Het
Sgcg A T 14: 61,245,764 F63I probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc2a13 T A 15: 91,516,492 I176F probably benign Het
Smc6 A G 12: 11,289,986 T432A probably benign Het
Snx25 G A 8: 46,056,113 P478L probably damaging Het
Taf2 A T 15: 55,016,486 H1151Q probably damaging Het
Thsd1 A G 8: 22,259,657 K795R possibly damaging Het
Tmem108 G A 9: 103,484,777 L537F possibly damaging Het
Ubr3 T C 2: 69,936,017 Y410H probably damaging Het
Vav3 T C 3: 109,647,739 probably null Het
Vmn1r224 T C 17: 20,419,262 Y34H probably benign Het
Zeb1 T C 18: 5,766,458 V323A possibly damaging Het
Zfp652 A G 11: 95,754,008 D240G probably benign Het
Zfp963 A T 8: 69,743,346 C152* probably null Het
Other mutations in Olfr304
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Olfr304 APN 7 86386000 missense possibly damaging 0.95
IGL02152:Olfr304 APN 7 86386043 missense probably benign 0.00
IGL02540:Olfr304 APN 7 86386178 missense possibly damaging 0.86
IGL03108:Olfr304 APN 7 86385721 missense possibly damaging 0.95
IGL03374:Olfr304 APN 7 86386366 missense probably damaging 1.00
R0040:Olfr304 UTSW 7 86386507 missense probably benign 0.01
R0130:Olfr304 UTSW 7 86386306 missense probably damaging 1.00
R0194:Olfr304 UTSW 7 86386374 nonsense probably null
R0267:Olfr304 UTSW 7 86386267 missense possibly damaging 0.64
R1026:Olfr304 UTSW 7 86386259 missense probably damaging 0.98
R1865:Olfr304 UTSW 7 86386561 missense probably damaging 1.00
R3607:Olfr304 UTSW 7 86385695 missense probably benign
R3861:Olfr304 UTSW 7 86386123 missense possibly damaging 0.60
R3909:Olfr304 UTSW 7 86385974 missense probably benign 0.05
R4113:Olfr304 UTSW 7 86386525 missense possibly damaging 0.83
R5268:Olfr304 UTSW 7 86385659 makesense probably null
R5649:Olfr304 UTSW 7 86386313 missense probably damaging 1.00
R6343:Olfr304 UTSW 7 86385851 nonsense probably null
R7716:Olfr304 UTSW 7 86386054 missense probably benign 0.22
X0054:Olfr304 UTSW 7 86385730 missense probably benign 0.00
X0063:Olfr304 UTSW 7 86386492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGGGAGGCTTCAGATAG -3'
(R):5'- GCTCTCCTCTGTGTTATGAGGC -3'

Sequencing Primer
(F):5'- GCTTCAGATAGACAAAGCAAGC -3'
(R):5'- CAATCATGAGTAGTGGTAACTGTG -3'
Posted On2014-09-18