Incidental Mutation 'R2090:Taf2'
ID231734
Institutional Source Beutler Lab
Gene Symbol Taf2
Ensembl Gene ENSMUSG00000037343
Gene NameTATA-box binding protein associated factor 2
SynonymsCIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150
MMRRC Submission 040095-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2090 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location55015131-55072152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55016486 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1151 (H1151Q)
Ref Sequence ENSEMBL: ENSMUSP00000043733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041733]
Predicted Effect probably damaging
Transcript: ENSMUST00000041733
AA Change: H1151Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: H1151Q

DomainStartEndE-ValueType
Pfam:Peptidase_M1 21 406 5.6e-17 PFAM
SCOP:d1gw5a_ 606 973 6e-7 SMART
low complexity region 987 998 N/A INTRINSIC
low complexity region 1142 1175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228896
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,676 S283P probably benign Het
Adam32 A G 8: 24,901,440 probably null Het
Adcy7 A T 8: 88,315,857 T451S probably damaging Het
Adgrg3 A T 8: 95,039,930 T410S possibly damaging Het
Alg11 G T 8: 22,065,630 L302F possibly damaging Het
Ankrd17 A G 5: 90,298,046 V310A possibly damaging Het
Atg16l2 C T 7: 101,293,368 probably null Het
AY761184 A T 8: 21,702,789 W64R possibly damaging Het
B3gnt2 A G 11: 22,836,291 V299A probably benign Het
Birc6 A G 17: 74,662,796 N4258S probably benign Het
C2cd4d A G 3: 94,364,014 K196E probably benign Het
Cdr2l A G 11: 115,391,001 K111E probably damaging Het
Crtam T C 9: 40,984,316 Q41R possibly damaging Het
Cspp1 A G 1: 10,090,268 K560R possibly damaging Het
Dcaf15 A T 8: 84,097,771 Y571* probably null Het
Dpy19l4 T C 4: 11,304,344 Y99C probably benign Het
Edem3 C T 1: 151,804,826 probably benign Het
Enpp6 A T 8: 47,065,370 probably null Het
Fam26f A G 10: 34,126,362 S242P probably damaging Het
Foxf2 T A 13: 31,626,841 D254E probably benign Het
Gjb5 T C 4: 127,356,001 N117D probably benign Het
Glmn G A 5: 107,561,928 L337F probably damaging Het
Gsdmc2 T A 15: 63,826,826 Y307F probably benign Het
Gsdmc3 T A 15: 63,866,782 M144L probably benign Het
Ibtk A G 9: 85,720,993 I653T probably benign Het
Il24 T G 1: 130,884,837 D99A possibly damaging Het
Intu A G 3: 40,683,536 Q484R probably benign Het
Lsp1 T C 7: 142,491,807 probably benign Het
Mad1l1 A G 5: 140,009,256 S672P probably benign Het
Man2a2 A T 7: 80,364,110 probably benign Het
Morc3 C A 16: 93,866,453 H515N probably benign Het
Nav1 T C 1: 135,607,165 probably benign Het
Ndor1 A G 2: 25,249,218 L247P probably damaging Het
Nfkbiz A T 16: 55,816,455 F494L probably benign Het
Nr1d1 G A 11: 98,770,610 P277S probably damaging Het
Nrg2 T C 18: 36,018,443 D682G probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Oasl1 G A 5: 114,935,934 D301N probably damaging Het
Olfr1118 A T 2: 87,309,418 I230F probably benign Het
Olfr196 A G 16: 59,168,140 M1T probably null Het
Olfr304 A T 7: 86,386,081 I193N probably benign Het
Palmd A G 3: 116,927,434 S123P probably damaging Het
Patj A G 4: 98,437,323 probably benign Het
Pcsk4 T C 10: 80,325,821 D162G probably benign Het
Plppr5 A G 3: 117,575,871 D59G possibly damaging Het
Pmvk A C 3: 89,461,882 R11S possibly damaging Het
Pnliprp1 A G 19: 58,740,469 T363A probably benign Het
Poll A T 19: 45,558,838 I65N probably benign Het
Prox1 T A 1: 190,160,812 S479C probably damaging Het
Prss50 A T 9: 110,862,293 S222C probably damaging Het
Rasa3 A C 8: 13,582,381 probably benign Het
Sec14l3 T C 11: 4,075,481 V335A probably benign Het
Setbp1 C T 18: 78,856,720 S1244N probably benign Het
Sgcg A T 14: 61,245,764 F63I probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc2a13 T A 15: 91,516,492 I176F probably benign Het
Smc6 A G 12: 11,289,986 T432A probably benign Het
Snx25 G A 8: 46,056,113 P478L probably damaging Het
Thsd1 A G 8: 22,259,657 K795R possibly damaging Het
Tmem108 G A 9: 103,484,777 L537F possibly damaging Het
Ubr3 T C 2: 69,936,017 Y410H probably damaging Het
Vav3 T C 3: 109,647,739 probably null Het
Vmn1r224 T C 17: 20,419,262 Y34H probably benign Het
Zeb1 T C 18: 5,766,458 V323A possibly damaging Het
Zfp652 A G 11: 95,754,008 D240G probably benign Het
Zfp963 A T 8: 69,743,346 C152* probably null Het
Other mutations in Taf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Taf2 APN 15 55071449 critical splice acceptor site probably null
IGL00475:Taf2 APN 15 55055850 nonsense probably null
IGL00549:Taf2 APN 15 55031115 missense probably benign 0.03
IGL00839:Taf2 APN 15 55045778 nonsense probably null
IGL01089:Taf2 APN 15 55016581 missense probably benign
IGL01305:Taf2 APN 15 55048274 missense probably damaging 0.99
IGL01532:Taf2 APN 15 55049486 missense possibly damaging 0.94
IGL01903:Taf2 APN 15 55060016 missense probably benign 0.03
IGL02324:Taf2 APN 15 55028376 missense probably benign
IGL02328:Taf2 APN 15 55028376 missense probably benign
IGL02405:Taf2 APN 15 55034155 splice site probably benign
IGL02671:Taf2 APN 15 55034176 missense probably benign 0.01
IGL02832:Taf2 APN 15 55016563 missense probably benign 0.01
IGL03105:Taf2 APN 15 55045799 missense probably benign 0.26
IGL03118:Taf2 APN 15 55052163 missense probably damaging 1.00
ANU22:Taf2 UTSW 15 55048274 missense probably damaging 0.99
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0183:Taf2 UTSW 15 55055790 missense possibly damaging 0.89
R0326:Taf2 UTSW 15 55047460 missense probably damaging 0.97
R0362:Taf2 UTSW 15 55045929 missense probably damaging 1.00
R0423:Taf2 UTSW 15 55064682 missense probably benign 0.02
R0562:Taf2 UTSW 15 55022188 splice site probably benign
R0609:Taf2 UTSW 15 55060050 missense probably damaging 1.00
R0655:Taf2 UTSW 15 55038294 missense probably damaging 1.00
R0689:Taf2 UTSW 15 55063065 missense possibly damaging 0.60
R0743:Taf2 UTSW 15 55016461 small deletion probably benign
R0898:Taf2 UTSW 15 55060084 missense probably damaging 0.97
R0969:Taf2 UTSW 15 55031157 critical splice acceptor site probably null
R0974:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1160:Taf2 UTSW 15 55071397 missense probably benign 0.01
R1376:Taf2 UTSW 15 55016461 small deletion probably benign
R1388:Taf2 UTSW 15 55036625 missense probably benign 0.00
R1416:Taf2 UTSW 15 55038410 missense possibly damaging 0.95
R1458:Taf2 UTSW 15 55059915 missense probably damaging 0.99
R1477:Taf2 UTSW 15 55062172 missense possibly damaging 0.87
R1755:Taf2 UTSW 15 55016454 missense probably damaging 1.00
R1766:Taf2 UTSW 15 55071397 missense probably benign 0.01
R2228:Taf2 UTSW 15 55064646 missense possibly damaging 0.94
R2519:Taf2 UTSW 15 55052247 missense probably benign 0.03
R4073:Taf2 UTSW 15 55052237 missense probably damaging 1.00
R4470:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4471:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4472:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4716:Taf2 UTSW 15 55065968 missense probably benign 0.02
R4937:Taf2 UTSW 15 55027223 nonsense probably null
R5082:Taf2 UTSW 15 55060045 missense probably benign 0.41
R5335:Taf2 UTSW 15 55045740 missense probably benign 0.14
R5383:Taf2 UTSW 15 55049419 missense possibly damaging 0.78
R5771:Taf2 UTSW 15 55059939 missense probably benign 0.01
R5862:Taf2 UTSW 15 55048323 missense possibly damaging 0.95
R5873:Taf2 UTSW 15 55038422 missense probably benign 0.00
R5908:Taf2 UTSW 15 55072006 unclassified probably benign
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6159:Taf2 UTSW 15 55063044 missense possibly damaging 0.48
R6568:Taf2 UTSW 15 55064630 missense probably damaging 1.00
R7094:Taf2 UTSW 15 55060086 missense probably benign 0.27
R7174:Taf2 UTSW 15 55048739 missense possibly damaging 0.51
R7241:Taf2 UTSW 15 55062141 missense probably benign 0.01
R7561:Taf2 UTSW 15 55055833 missense probably benign 0.16
R7583:Taf2 UTSW 15 55064676 nonsense probably null
R7818:Taf2 UTSW 15 55065930 missense probably benign
R7905:Taf2 UTSW 15 55047432 missense possibly damaging 0.90
R8006:Taf2 UTSW 15 55048701 missense probably damaging 1.00
R8017:Taf2 UTSW 15 55064617 missense possibly damaging 0.66
R8019:Taf2 UTSW 15 55064617 missense possibly damaging 0.66
R8119:Taf2 UTSW 15 55031130 missense probably benign 0.00
R8127:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8128:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8129:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8278:Taf2 UTSW 15 55065965 nonsense probably null
R8290:Taf2 UTSW 15 55063020 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGACATCCTCTGCAGTCTCTC -3'
(R):5'- ACCCATGAGTCTGTCATCAGC -3'

Sequencing Primer
(F):5'- GCAGTCTCTCCACACTCCCTG -3'
(R):5'- GTCATCAGCTTCCTCTGAGG -3'
Posted On2014-09-18