Mutagenetix > Incidental Mutations

Incidental Mutation 'R2090:Taf2'

231734

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

040095-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2090 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55016486 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1151 (H1151Q)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041733
AA Change: H1151Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: H1151Q

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228345

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228896

Meta Mutation Damage Score

0.1224

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,550,676	S283P	probably benign	Het
Adam32	A	G	8: 24,901,440		probably null	Het
Adcy7	A	T	8: 88,315,857	T451S	probably damaging	Het
Adgrg3	A	T	8: 95,039,930	T410S	possibly damaging	Het
Alg11	G	T	8: 22,065,630	L302F	possibly damaging	Het
Ankrd17	A	G	5: 90,298,046	V310A	possibly damaging	Het
Atg16l2	C	T	7: 101,293,368		probably null	Het
AY761184	A	T	8: 21,702,789	W64R	possibly damaging	Het
B3gnt2	A	G	11: 22,836,291	V299A	probably benign	Het
Birc6	A	G	17: 74,662,796	N4258S	probably benign	Het
C2cd4d	A	G	3: 94,364,014	K196E	probably benign	Het
Cdr2l	A	G	11: 115,391,001	K111E	probably damaging	Het
Crtam	T	C	9: 40,984,316	Q41R	possibly damaging	Het
Cspp1	A	G	1: 10,090,268	K560R	possibly damaging	Het
Dcaf15	A	T	8: 84,097,771	Y571*	probably null	Het
Dpy19l4	T	C	4: 11,304,344	Y99C	probably benign	Het
Edem3	C	T	1: 151,804,826		probably benign	Het
Enpp6	A	T	8: 47,065,370		probably null	Het
Fam26f	A	G	10: 34,126,362	S242P	probably damaging	Het
Foxf2	T	A	13: 31,626,841	D254E	probably benign	Het
Gjb5	T	C	4: 127,356,001	N117D	probably benign	Het
Glmn	G	A	5: 107,561,928	L337F	probably damaging	Het
Gsdmc2	T	A	15: 63,826,826	Y307F	probably benign	Het
Gsdmc3	T	A	15: 63,866,782	M144L	probably benign	Het
Ibtk	A	G	9: 85,720,993	I653T	probably benign	Het
Il24	T	G	1: 130,884,837	D99A	possibly damaging	Het
Intu	A	G	3: 40,683,536	Q484R	probably benign	Het
Lsp1	T	C	7: 142,491,807		probably benign	Het
Mad1l1	A	G	5: 140,009,256	S672P	probably benign	Het
Man2a2	A	T	7: 80,364,110		probably benign	Het
Morc3	C	A	16: 93,866,453	H515N	probably benign	Het
Nav1	T	C	1: 135,607,165		probably benign	Het
Ndor1	A	G	2: 25,249,218	L247P	probably damaging	Het
Nfkbiz	A	T	16: 55,816,455	F494L	probably benign	Het
Nr1d1	G	A	11: 98,770,610	P277S	probably damaging	Het
Nrg2	T	C	18: 36,018,443	D682G	probably benign	Het
Nrros	C	T	16: 32,144,157	W311*	probably null	Het
Oasl1	G	A	5: 114,935,934	D301N	probably damaging	Het
Olfr1118	A	T	2: 87,309,418	I230F	probably benign	Het
Olfr196	A	G	16: 59,168,140	M1T	probably null	Het
Olfr304	A	T	7: 86,386,081	I193N	probably benign	Het
Palmd	A	G	3: 116,927,434	S123P	probably damaging	Het
Patj	A	G	4: 98,437,323		probably benign	Het
Pcsk4	T	C	10: 80,325,821	D162G	probably benign	Het
Plppr5	A	G	3: 117,575,871	D59G	possibly damaging	Het
Pmvk	A	C	3: 89,461,882	R11S	possibly damaging	Het
Pnliprp1	A	G	19: 58,740,469	T363A	probably benign	Het
Poll	A	T	19: 45,558,838	I65N	probably benign	Het
Prox1	T	A	1: 190,160,812	S479C	probably damaging	Het
Prss50	A	T	9: 110,862,293	S222C	probably damaging	Het
Rasa3	A	C	8: 13,582,381		probably benign	Het
Sec14l3	T	C	11: 4,075,481	V335A	probably benign	Het
Setbp1	C	T	18: 78,856,720	S1244N	probably benign	Het
Sgcg	A	T	14: 61,245,764	F63I	probably damaging	Het
Skp2	C	A	15: 9,113,698	G376C	probably damaging	Het
Slc2a13	T	A	15: 91,516,492	I176F	probably benign	Het
Smc6	A	G	12: 11,289,986	T432A	probably benign	Het
Snx25	G	A	8: 46,056,113	P478L	probably damaging	Het
Thsd1	A	G	8: 22,259,657	K795R	possibly damaging	Het
Tmem108	G	A	9: 103,484,777	L537F	possibly damaging	Het
Ubr3	T	C	2: 69,936,017	Y410H	probably damaging	Het
Vav3	T	C	3: 109,647,739		probably null	Het
Vmn1r224	T	C	17: 20,419,262	Y34H	probably benign	Het
Zeb1	T	C	18: 5,766,458	V323A	possibly damaging	Het
Zfp652	A	G	11: 95,754,008	D240G	probably benign	Het
Zfp963	A	T	8: 69,743,346	C152*	probably null	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATAGACATCCTCTGCAGTCTCTC -3'
(R):5'- ACCCATGAGTCTGTCATCAGC -3'

Sequencing Primer
(F):5'- GCAGTCTCTCCACACTCCCTG -3'
(R):5'- GTCATCAGCTTCCTCTGAGG -3'

Posted On

2014-09-18