Incidental Mutation 'R2090:Nfkbiz'
ID231740
Institutional Source Beutler Lab
Gene Symbol Nfkbiz
Ensembl Gene ENSMUSG00000035356
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
SynonymsMail
MMRRC Submission 040095-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R2090 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location55811375-55838899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55816455 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 494 (F494L)
Ref Sequence ENSEMBL: ENSMUSP00000110102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036273] [ENSMUST00000096026] [ENSMUST00000114457] [ENSMUST00000114458]
Predicted Effect probably benign
Transcript: ENSMUST00000036273
AA Change: F494L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000041173
Gene: ENSMUSG00000035356
AA Change: F494L

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096026
AA Change: F395L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093726
Gene: ENSMUSG00000035356
AA Change: F395L

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114457
AA Change: F395L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000110101
Gene: ENSMUSG00000035356
AA Change: F395L

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114458
AA Change: F494L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000110102
Gene: ENSMUSG00000035356
AA Change: F494L

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231463
Meta Mutation Damage Score 0.1428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to background sensitive prenatal lethality and results in abnormal cytokine secretion, higher IgE levels, ocular surface and perioral skin inflammation accompanied by hair loss, and severe atopic dermatitis-like skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,676 S283P probably benign Het
Adam32 A G 8: 24,901,440 probably null Het
Adcy7 A T 8: 88,315,857 T451S probably damaging Het
Adgrg3 A T 8: 95,039,930 T410S possibly damaging Het
Alg11 G T 8: 22,065,630 L302F possibly damaging Het
Ankrd17 A G 5: 90,298,046 V310A possibly damaging Het
Atg16l2 C T 7: 101,293,368 probably null Het
AY761184 A T 8: 21,702,789 W64R possibly damaging Het
B3gnt2 A G 11: 22,836,291 V299A probably benign Het
Birc6 A G 17: 74,662,796 N4258S probably benign Het
C2cd4d A G 3: 94,364,014 K196E probably benign Het
Cdr2l A G 11: 115,391,001 K111E probably damaging Het
Crtam T C 9: 40,984,316 Q41R possibly damaging Het
Cspp1 A G 1: 10,090,268 K560R possibly damaging Het
Dcaf15 A T 8: 84,097,771 Y571* probably null Het
Dpy19l4 T C 4: 11,304,344 Y99C probably benign Het
Edem3 C T 1: 151,804,826 probably benign Het
Enpp6 A T 8: 47,065,370 probably null Het
Fam26f A G 10: 34,126,362 S242P probably damaging Het
Foxf2 T A 13: 31,626,841 D254E probably benign Het
Gjb5 T C 4: 127,356,001 N117D probably benign Het
Glmn G A 5: 107,561,928 L337F probably damaging Het
Gsdmc2 T A 15: 63,826,826 Y307F probably benign Het
Gsdmc3 T A 15: 63,866,782 M144L probably benign Het
Ibtk A G 9: 85,720,993 I653T probably benign Het
Il24 T G 1: 130,884,837 D99A possibly damaging Het
Intu A G 3: 40,683,536 Q484R probably benign Het
Lsp1 T C 7: 142,491,807 probably benign Het
Mad1l1 A G 5: 140,009,256 S672P probably benign Het
Man2a2 A T 7: 80,364,110 probably benign Het
Morc3 C A 16: 93,866,453 H515N probably benign Het
Nav1 T C 1: 135,607,165 probably benign Het
Ndor1 A G 2: 25,249,218 L247P probably damaging Het
Nr1d1 G A 11: 98,770,610 P277S probably damaging Het
Nrg2 T C 18: 36,018,443 D682G probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Oasl1 G A 5: 114,935,934 D301N probably damaging Het
Olfr1118 A T 2: 87,309,418 I230F probably benign Het
Olfr196 A G 16: 59,168,140 M1T probably null Het
Olfr304 A T 7: 86,386,081 I193N probably benign Het
Palmd A G 3: 116,927,434 S123P probably damaging Het
Patj A G 4: 98,437,323 probably benign Het
Pcsk4 T C 10: 80,325,821 D162G probably benign Het
Plppr5 A G 3: 117,575,871 D59G possibly damaging Het
Pmvk A C 3: 89,461,882 R11S possibly damaging Het
Pnliprp1 A G 19: 58,740,469 T363A probably benign Het
Poll A T 19: 45,558,838 I65N probably benign Het
Prox1 T A 1: 190,160,812 S479C probably damaging Het
Prss50 A T 9: 110,862,293 S222C probably damaging Het
Rasa3 A C 8: 13,582,381 probably benign Het
Sec14l3 T C 11: 4,075,481 V335A probably benign Het
Setbp1 C T 18: 78,856,720 S1244N probably benign Het
Sgcg A T 14: 61,245,764 F63I probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc2a13 T A 15: 91,516,492 I176F probably benign Het
Smc6 A G 12: 11,289,986 T432A probably benign Het
Snx25 G A 8: 46,056,113 P478L probably damaging Het
Taf2 A T 15: 55,016,486 H1151Q probably damaging Het
Thsd1 A G 8: 22,259,657 K795R possibly damaging Het
Tmem108 G A 9: 103,484,777 L537F possibly damaging Het
Ubr3 T C 2: 69,936,017 Y410H probably damaging Het
Vav3 T C 3: 109,647,739 probably null Het
Vmn1r224 T C 17: 20,419,262 Y34H probably benign Het
Zeb1 T C 18: 5,766,458 V323A possibly damaging Het
Zfp652 A G 11: 95,754,008 D240G probably benign Het
Zfp963 A T 8: 69,743,346 C152* probably null Het
Other mutations in Nfkbiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nfkbiz APN 16 55817909 missense probably benign
IGL01324:Nfkbiz APN 16 55815804 missense probably damaging 1.00
IGL02086:Nfkbiz APN 16 55815671 missense probably damaging 1.00
IGL02627:Nfkbiz APN 16 55816351 missense probably damaging 1.00
IGL02740:Nfkbiz APN 16 55817954 missense probably benign
R0349:Nfkbiz UTSW 16 55818991 critical splice donor site probably null
R0539:Nfkbiz UTSW 16 55817879 missense probably benign 0.08
R0827:Nfkbiz UTSW 16 55816367 missense probably damaging 1.00
R1403:Nfkbiz UTSW 16 55816470 splice site probably benign
R1743:Nfkbiz UTSW 16 55816394 missense possibly damaging 0.82
R2163:Nfkbiz UTSW 16 55818218 missense probably benign 0.00
R3195:Nfkbiz UTSW 16 55819628 missense probably damaging 1.00
R3974:Nfkbiz UTSW 16 55818436 missense probably benign 0.42
R4513:Nfkbiz UTSW 16 55816841 missense probably benign 0.20
R4765:Nfkbiz UTSW 16 55819024 critical splice acceptor site probably null
R4864:Nfkbiz UTSW 16 55818424 missense probably damaging 1.00
R5134:Nfkbiz UTSW 16 55818500 missense probably damaging 1.00
R5265:Nfkbiz UTSW 16 55819641 missense probably damaging 1.00
R5510:Nfkbiz UTSW 16 55814020 missense probably damaging 1.00
R6327:Nfkbiz UTSW 16 55821962 missense probably damaging 1.00
R7083:Nfkbiz UTSW 16 55818300 missense possibly damaging 0.88
R7369:Nfkbiz UTSW 16 55821846 missense probably damaging 1.00
R7650:Nfkbiz UTSW 16 55817839 missense probably benign 0.34
Z1088:Nfkbiz UTSW 16 55816438 missense probably damaging 1.00
Z1088:Nfkbiz UTSW 16 55818236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAACGGCTCATATCCAAG -3'
(R):5'- ATTGCGTATAATTAAGCCGCAC -3'

Sequencing Primer
(F):5'- CACATCTTTTGATAACAGAAGCCTGC -3'
(R):5'- AAGCCGCACCCTAAGCTTATTTTAG -3'
Posted On2014-09-18