Incidental Mutation 'R2091:4921504E06Rik'
ID231756
Institutional Source Beutler Lab
Gene Symbol 4921504E06Rik
Ensembl Gene ENSMUSG00000026734
Gene NameRIKEN cDNA 4921504E06 gene
Synonyms
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location19462837-19553914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 19517546 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 247 (N247K)
Ref Sequence ENSEMBL: ENSMUSP00000058720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062060]
Predicted Effect probably damaging
Transcript: ENSMUST00000062060
AA Change: N247K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058720
Gene: ENSMUSG00000026734
AA Change: N247K

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:DUF4709 36 145 1e-45 PFAM
coiled coil region 165 257 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
coiled coil region 417 463 N/A INTRINSIC
Pfam:DUF4724 477 559 3.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131199
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
AC124724.1 T A 19: 47,151,991 D221V probably damaging Het
Adam9 A T 8: 24,995,184 probably benign Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Angpt4 A T 2: 151,936,783 probably benign Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Etnk2 T G 1: 133,377,053 probably null Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gbp7 A T 3: 142,545,555 probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Hook3 A T 8: 26,059,394 probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pik3cd A G 4: 149,652,699 L880P probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Polh A T 17: 46,181,454 probably benign Het
Prom1 T C 5: 44,014,086 probably benign Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Unc80 T A 1: 66,671,715 probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in 4921504E06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:4921504E06Rik APN 2 19540371 missense probably benign 0.06
IGL01590:4921504E06Rik APN 2 19477779 splice site probably benign
IGL02264:4921504E06Rik APN 2 19542369 splice site probably null
IGL02591:4921504E06Rik APN 2 19480438 missense probably benign 0.26
H8786:4921504E06Rik UTSW 2 19494094 missense probably benign 0.04
R0545:4921504E06Rik UTSW 2 19542376 missense probably damaging 1.00
R0762:4921504E06Rik UTSW 2 19477856 missense probably damaging 0.97
R1325:4921504E06Rik UTSW 2 19495127 missense possibly damaging 0.71
R1456:4921504E06Rik UTSW 2 19480920 critical splice donor site probably null
R2013:4921504E06Rik UTSW 2 19540313 missense probably benign 0.01
R2089:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R2091:4921504E06Rik UTSW 2 19517546 missense probably damaging 1.00
R3922:4921504E06Rik UTSW 2 19480560 missense probably benign 0.00
R3982:4921504E06Rik UTSW 2 19542369 splice site probably null
R3983:4921504E06Rik UTSW 2 19542369 splice site probably null
R4074:4921504E06Rik UTSW 2 19480590 missense probably damaging 0.96
R4995:4921504E06Rik UTSW 2 19494184 nonsense probably null
R5303:4921504E06Rik UTSW 2 19516299 missense possibly damaging 0.92
R5308:4921504E06Rik UTSW 2 19524081 missense probably damaging 1.00
R6227:4921504E06Rik UTSW 2 19553770 splice site probably null
R6253:4921504E06Rik UTSW 2 19524118 missense possibly damaging 0.53
R6268:4921504E06Rik UTSW 2 19540408 missense probably benign 0.10
R6496:4921504E06Rik UTSW 2 19540406 missense probably benign 0.17
R7196:4921504E06Rik UTSW 2 19493995 missense probably benign 0.00
R7472:4921504E06Rik UTSW 2 19540408 missense probably benign 0.10
Z1177:4921504E06Rik UTSW 2 19480532 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CACAAGGCAAGGCTCAGTAG -3'
(R):5'- GTTGCGTATTTAAATCCTTGGCTCC -3'

Sequencing Primer
(F):5'- GGCTCAGTAGCACAAATATAG -3'
(R):5'- GGCTCCCTGCTTAGAAATATGG -3'
Posted On2014-09-18