Incidental Mutation 'R2091:Hat1'
ID231758
Institutional Source Beutler Lab
Gene Symbol Hat1
Ensembl Gene ENSMUSG00000027018
Gene Namehistone aminotransferase 1
Synonyms2410071B14Rik, KAT1
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location71388958-71441622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71434034 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 272 (V272A)
Ref Sequence ENSEMBL: ENSMUSP00000107750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028408] [ENSMUST00000112122]
Predicted Effect probably benign
Transcript: ENSMUST00000028408
SMART Domains Protein: ENSMUSP00000028408
Gene: ENSMUSG00000027018

DomainStartEndE-ValueType
Pfam:Hat1_N 23 184 1.3e-49 PFAM
coiled coil region 386 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112122
AA Change: V272A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107750
Gene: ENSMUSG00000027018
AA Change: V272A

DomainStartEndE-ValueType
Pfam:Hat1_N 22 184 4.4e-49 PFAM
coiled coil region 393 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145147
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal, perinatal and neonatal lethality with impaired lung maturation, atelectasis, respiratory failure, craniofacial defects and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
AC124724.1 T A 19: 47,151,991 D221V probably damaging Het
Adam9 A T 8: 24,995,184 probably benign Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Angpt4 A T 2: 151,936,783 probably benign Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Etnk2 T G 1: 133,377,053 probably null Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gbp7 A T 3: 142,545,555 probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hook3 A T 8: 26,059,394 probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pik3cd A G 4: 149,652,699 L880P probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Polh A T 17: 46,181,454 probably benign Het
Prom1 T C 5: 44,014,086 probably benign Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Unc80 T A 1: 66,671,715 probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Hat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Hat1 APN 2 71421260 missense probably damaging 1.00
IGL02945:Hat1 APN 2 71420693 missense probably benign 0.01
IGL02796:Hat1 UTSW 2 71420356 critical splice donor site probably null
R0789:Hat1 UTSW 2 71421744 splice site probably benign
R0907:Hat1 UTSW 2 71420617 nonsense probably null
R1412:Hat1 UTSW 2 71420617 nonsense probably null
R1571:Hat1 UTSW 2 71434175 missense probably benign
R1868:Hat1 UTSW 2 71421283 nonsense probably null
R1981:Hat1 UTSW 2 71389977 missense probably benign 0.01
R2064:Hat1 UTSW 2 71410160 missense possibly damaging 0.71
R2089:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R4115:Hat1 UTSW 2 71441222 missense probably benign 0.01
R5579:Hat1 UTSW 2 71410238 missense possibly damaging 0.86
R5650:Hat1 UTSW 2 71434034 missense probably benign 0.12
R5681:Hat1 UTSW 2 71434209 splice site probably null
R5895:Hat1 UTSW 2 71409013 missense possibly damaging 0.67
R6075:Hat1 UTSW 2 71410241 missense probably benign 0.29
R6621:Hat1 UTSW 2 71421715 missense probably benign 0.00
R7155:Hat1 UTSW 2 71421251 missense possibly damaging 0.95
R7506:Hat1 UTSW 2 71420347 missense probably damaging 1.00
R7644:Hat1 UTSW 2 71410181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACATTGACTGCAGCTAA -3'
(R):5'- CCACACATCTTAATGTCCTTACAAT -3'

Sequencing Primer
(F):5'- TTTAACCCCAGCATTCAGGAGG -3'
(R):5'- TCTTTCCCGGGAGAAACT -3'
Posted On2014-09-18