Incidental Mutation 'R2091:Gbp7'
ID231763
Institutional Source Beutler Lab
Gene Symbol Gbp7
Ensembl Gene ENSMUSG00000040253
Gene Nameguanylate binding protein 7
Synonyms9830147J24Rik
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142530342-142550149 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 142545555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045097] [ENSMUST00000171263]
Predicted Effect probably benign
Transcript: ENSMUST00000045097
SMART Domains Protein: ENSMUSP00000049104
Gene: ENSMUSG00000040253

DomainStartEndE-ValueType
Pfam:GBP 18 281 6.6e-128 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171263
SMART Domains Protein: ENSMUSP00000132970
Gene: ENSMUSG00000040253

DomainStartEndE-ValueType
Pfam:GBP 18 281 1e-126 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197826
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylate-binding proteins, such as GBP7, are induced by interferon and hydrolyze GTP to both GDP and GMP (Olszewski et al., 2006 [PubMed 16689661]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
AC124724.1 T A 19: 47,151,991 D221V probably damaging Het
Adam9 A T 8: 24,995,184 probably benign Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Angpt4 A T 2: 151,936,783 probably benign Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Etnk2 T G 1: 133,377,053 probably null Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Hook3 A T 8: 26,059,394 probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pik3cd A G 4: 149,652,699 L880P probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Polh A T 17: 46,181,454 probably benign Het
Prom1 T C 5: 44,014,086 probably benign Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Unc80 T A 1: 66,671,715 probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Gbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gbp7 APN 3 142546428 missense probably benign 0.01
IGL01020:Gbp7 APN 3 142542857 missense probably benign 0.03
IGL01959:Gbp7 APN 3 142541347 splice site probably benign
IGL02002:Gbp7 APN 3 142538900 missense probably damaging 1.00
IGL02008:Gbp7 APN 3 142546450 missense probably benign 0.11
PIT4366001:Gbp7 UTSW 3 142542951 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0398:Gbp7 UTSW 3 142545513 missense possibly damaging 0.93
R0486:Gbp7 UTSW 3 142546317 splice site probably benign
R0645:Gbp7 UTSW 3 142538165 intron probably null
R0961:Gbp7 UTSW 3 142541557 nonsense probably null
R1834:Gbp7 UTSW 3 142534680 missense probably damaging 1.00
R2089:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2089:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2181:Gbp7 UTSW 3 142544030 missense possibly damaging 0.87
R2921:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R2922:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R3819:Gbp7 UTSW 3 142544065 missense possibly damaging 0.81
R4747:Gbp7 UTSW 3 142543017 missense probably damaging 1.00
R4748:Gbp7 UTSW 3 142538087 missense probably benign 0.00
R5899:Gbp7 UTSW 3 142546542 missense probably benign
R6082:Gbp7 UTSW 3 142545936 missense probably benign 0.01
R6211:Gbp7 UTSW 3 142545993 missense probably benign 0.12
R6330:Gbp7 UTSW 3 142546498 missense probably benign
R6419:Gbp7 UTSW 3 142546453 missense probably benign 0.00
R7120:Gbp7 UTSW 3 142543973 missense probably damaging 1.00
R7338:Gbp7 UTSW 3 142538025 missense probably damaging 1.00
R7844:Gbp7 UTSW 3 142536386 missense probably benign 0.10
R7910:Gbp7 UTSW 3 142534641 missense probably damaging 1.00
R7927:Gbp7 UTSW 3 142536386 missense probably benign 0.10
R7991:Gbp7 UTSW 3 142534641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTAGTGAGCAGCCACAC -3'
(R):5'- CCCAGATGACTTTGAACCATGC -3'

Sequencing Primer
(F):5'- GTAGTGAGCAGCCACACAAACC -3'
(R):5'- CCAGATGACTTTGAACCATGCAAGAG -3'
Posted On2014-09-18