Incidental Mutation 'R2091:Bicdl1'
ID231771
Institutional Source Beutler Lab
Gene Symbol Bicdl1
Ensembl Gene ENSMUSG00000041609
Gene NameBICD family like cargo adaptor 1
Synonyms2210403N09Rik, Ccdc64, BICDR-1
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115648175-115731621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115724579 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 206 (S206P)
Ref Sequence ENSEMBL: ENSMUSP00000053547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055408] [ENSMUST00000141950]
Predicted Effect probably damaging
Transcript: ENSMUST00000055408
AA Change: S206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609
AA Change: S206P

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141950
AA Change: S142P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119015
Gene: ENSMUSG00000041609
AA Change: S142P

DomainStartEndE-ValueType
Pfam:HAP1_N 35 99 4.5e-11 PFAM
coiled coil region 192 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148840
Meta Mutation Damage Score 0.1699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
AC124724.1 T A 19: 47,151,991 D221V probably damaging Het
Adam9 A T 8: 24,995,184 probably benign Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Angpt4 A T 2: 151,936,783 probably benign Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Etnk2 T G 1: 133,377,053 probably null Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gbp7 A T 3: 142,545,555 probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Hook3 A T 8: 26,059,394 probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pik3cd A G 4: 149,652,699 L880P probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Polh A T 17: 46,181,454 probably benign Het
Prom1 T C 5: 44,014,086 probably benign Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Unc80 T A 1: 66,671,715 probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Bicdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Bicdl1 APN 5 115670156 nonsense probably null
IGL01902:Bicdl1 APN 5 115651874 missense probably damaging 1.00
IGL02416:Bicdl1 APN 5 115663885 missense probably damaging 1.00
IGL02417:Bicdl1 APN 5 115673158 missense probably damaging 1.00
IGL03088:Bicdl1 APN 5 115663822 missense possibly damaging 0.83
IGL03275:Bicdl1 APN 5 115731160 missense probably damaging 1.00
bargain UTSW 5 115670153 critical splice donor site probably null
R6807_Bicdl1_588 UTSW 5 115672143 critical splice donor site probably null
R0837:Bicdl1 UTSW 5 115731292 missense probably benign 0.06
R0924:Bicdl1 UTSW 5 115661528 splice site probably benign
R1581:Bicdl1 UTSW 5 115651267 unclassified probably benign
R1589:Bicdl1 UTSW 5 115651266 unclassified probably benign
R1669:Bicdl1 UTSW 5 115656016 missense possibly damaging 0.84
R2076:Bicdl1 UTSW 5 115655928 missense probably damaging 0.96
R2089:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R2091:Bicdl1 UTSW 5 115724579 missense probably damaging 1.00
R4772:Bicdl1 UTSW 5 115661478 missense probably benign 0.36
R6185:Bicdl1 UTSW 5 115670153 critical splice donor site probably null
R6807:Bicdl1 UTSW 5 115672143 critical splice donor site probably null
R7107:Bicdl1 UTSW 5 115670170 missense probably benign 0.03
R7157:Bicdl1 UTSW 5 115651857 missense possibly damaging 0.92
R7205:Bicdl1 UTSW 5 115670281 missense probably damaging 1.00
R7485:Bicdl1 UTSW 5 115663786 nonsense probably null
R7781:Bicdl1 UTSW 5 115661487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCATGTAGTTCAACTCCG -3'
(R):5'- CTGTGAATTGGGCAACATGC -3'

Sequencing Primer
(F):5'- GTTCAACTCCGTAATCACTGGGAG -3'
(R):5'- AACATGCCCTGTGTGGCAG -3'
Posted On2014-09-18