Incidental Mutation 'R2091:Nrros'
ID231796
Institutional Source Beutler Lab
Gene Symbol Nrros
Ensembl Gene ENSMUSG00000052384
Gene Namenegative regulator of reactive oxygen species
SynonymsLrrc33, E430025L02Rik
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2091 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32142785-32165594 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 32144157 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 311 (W311*)
Ref Sequence ENSEMBL: ENSMUSP00000155965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099991] [ENSMUST00000115163] [ENSMUST00000115165] [ENSMUST00000126869] [ENSMUST00000130410] [ENSMUST00000143682] [ENSMUST00000144345] [ENSMUST00000231836]
Predicted Effect probably null
Transcript: ENSMUST00000099991
AA Change: W319*
SMART Domains Protein: ENSMUSP00000097571
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115163
AA Change: W347*
SMART Domains Protein: ENSMUSP00000110817
Gene: ENSMUSG00000052384
AA Change: W347*

DomainStartEndE-ValueType
LRRNT 59 89 1.05e1 SMART
LRR 108 131 1.01e2 SMART
LRR 159 183 5.27e1 SMART
LRR 184 207 4.05e-1 SMART
LRR_TYP 208 231 7.67e-2 SMART
LRR 232 255 1.49e1 SMART
LRR_TYP 355 378 1.67e-2 SMART
LRR 404 428 3.27e1 SMART
LRR_TYP 429 452 1.79e-2 SMART
LRR 489 512 1.45e1 SMART
LRR 563 584 1.76e1 SMART
LRR 587 608 3.36e1 SMART
transmembrane domain 681 703 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115165
AA Change: W295*
SMART Domains Protein: ENSMUSP00000110819
Gene: ENSMUSG00000052384
AA Change: W295*

DomainStartEndE-ValueType
Blast:LRRNT 8 37 5e-8 BLAST
LRR 56 79 1.01e2 SMART
LRR 107 131 5.27e1 SMART
LRR 132 155 4.05e-1 SMART
LRR_TYP 156 179 7.67e-2 SMART
LRR 180 203 1.49e1 SMART
LRR_TYP 303 326 1.67e-2 SMART
LRR 352 376 3.27e1 SMART
LRR_TYP 377 400 1.79e-2 SMART
LRR 437 460 1.45e1 SMART
LRR 511 532 1.76e1 SMART
LRR 535 556 3.36e1 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126869
AA Change: W319*
SMART Domains Protein: ENSMUSP00000116388
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127287
Predicted Effect probably benign
Transcript: ENSMUST00000130410
SMART Domains Protein: ENSMUSP00000122290
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Pfam:LRR_7 81 97 1.9e-2 PFAM
Pfam:LRR_7 105 121 6.8e-2 PFAM
Pfam:LRR_7 133 144 2e-1 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136809
Predicted Effect probably null
Transcript: ENSMUST00000143682
AA Change: W319*
SMART Domains Protein: ENSMUSP00000119349
Gene: ENSMUSG00000052384
AA Change: W319*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144345
SMART Domains Protein: ENSMUSP00000121492
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150250
Predicted Effect probably null
Transcript: ENSMUST00000231836
AA Change: W311*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased oxidative stress and susceptibility to experimental autoimmune encephalomyelitis, but to reduced susceptibility to bacterial infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
AC124724.1 T A 19: 47,151,991 D221V probably damaging Het
Adam9 A T 8: 24,995,184 probably benign Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Angpt4 A T 2: 151,936,783 probably benign Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Etnk2 T G 1: 133,377,053 probably null Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gbp7 A T 3: 142,545,555 probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Hook3 A T 8: 26,059,394 probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pik3cd A G 4: 149,652,699 L880P probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Polh A T 17: 46,181,454 probably benign Het
Prom1 T C 5: 44,014,086 probably benign Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Unc80 T A 1: 66,671,715 probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Nrros
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Nrros APN 16 32147620 missense probably benign 0.06
IGL01097:Nrros APN 16 32144185 missense possibly damaging 0.71
IGL02065:Nrros APN 16 32144674 missense possibly damaging 0.84
IGL03372:Nrros APN 16 32144770 missense probably damaging 1.00
R0615:Nrros UTSW 16 32144085 missense probably damaging 1.00
R0669:Nrros UTSW 16 32143423 missense probably damaging 1.00
R0840:Nrros UTSW 16 32143423 missense probably damaging 1.00
R1398:Nrros UTSW 16 32143144 missense probably damaging 0.98
R1796:Nrros UTSW 16 32143511 missense probably damaging 1.00
R2031:Nrros UTSW 16 32144157 nonsense probably null
R2033:Nrros UTSW 16 32144157 nonsense probably null
R2034:Nrros UTSW 16 32144157 nonsense probably null
R2087:Nrros UTSW 16 32144157 nonsense probably null
R2089:Nrros UTSW 16 32144157 nonsense probably null
R2090:Nrros UTSW 16 32144157 nonsense probably null
R2091:Nrros UTSW 16 32144157 nonsense probably null
R2151:Nrros UTSW 16 32143258 missense probably benign 0.11
R2438:Nrros UTSW 16 32144111 unclassified probably null
R2438:Nrros UTSW 16 32144299 missense probably benign 0.25
R5474:Nrros UTSW 16 32144352 missense probably benign 0.00
R5527:Nrros UTSW 16 32144470 missense probably damaging 1.00
R5629:Nrros UTSW 16 32144405 missense probably damaging 1.00
R5888:Nrros UTSW 16 32143087 missense probably benign 0.15
R5939:Nrros UTSW 16 32143454 missense probably benign 0.01
R5982:Nrros UTSW 16 32144593 missense probably damaging 0.96
R6869:Nrros UTSW 16 32144431 missense probably damaging 1.00
R6912:Nrros UTSW 16 32162239 missense probably null 0.01
R7010:Nrros UTSW 16 32143580 missense probably damaging 0.96
R7469:Nrros UTSW 16 32144212 missense probably benign 0.14
R7673:Nrros UTSW 16 32162281 missense unknown
R7770:Nrros UTSW 16 32143528 missense probably benign 0.01
X0022:Nrros UTSW 16 32143040 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACTGGTTGTGGCTCAGATC -3'
(R):5'- ACTGGACCTGTCTCACAACC -3'

Sequencing Primer
(F):5'- GTTGTGGCTCAGATCCAGCTC -3'
(R):5'- TGTCTCACAACCAGCTGC -3'
Posted On2014-09-18