Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:Slc40a1'

231805

Institutional Source

Beutler Lab

Gene Symbol

Slc40a1

Ensembl Gene

ENSMUSG00000025993

Gene Name

solute carrier family 40 (iron-regulated transporter), member 1

Synonyms

Dusg, metal transporting protein 1, Ol5, ferroportin1, IREG1, Slc11a3, FPN1, Pcm, MTP1

MMRRC Submission

040097-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45908068-45926523 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 45909454 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 555 (D555E)

Ref Sequence

ENSEMBL: ENSMUSP00000027137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027137]

Predicted Effect

probably benign
Transcript: ENSMUST00000027137
AA Change: D555E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027137
Gene: ENSMUSG00000025993
AA Change: D555E

Domain	Start	End	E-Value	Type
Pfam:FPN1	22	530	5e-194	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190055

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality before embryo turning. Mice heterozygous for a targeted mutation display decreased thermal response latency. Mice heterozygous for an ENU induced mutation display abnormal iron homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Slc40a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Slc40a1	APN	1	45909492	missense	probably benign	0.19
IGL01576:Slc40a1	APN	1	45909597	missense	probably damaging	1.00
IGL02113:Slc40a1	APN	1	45910894	missense	probably benign	0.33
IGL02116:Slc40a1	APN	1	45911528	missense	probably benign	0.01
IGL02220:Slc40a1	APN	1	45911335	missense	probably damaging	1.00
IGL02537:Slc40a1	APN	1	45911393	missense	probably benign	0.01
IGL02574:Slc40a1	APN	1	45912374	missense	possibly damaging	0.77
IGL02673:Slc40a1	APN	1	45918416	missense	possibly damaging	0.82
IGL02794:Slc40a1	APN	1	45909508	nonsense	probably null
R0376:Slc40a1	UTSW	1	45912491	splice site	probably benign
R0417:Slc40a1	UTSW	1	45911374	missense	possibly damaging	0.50
R1608:Slc40a1	UTSW	1	45911297	missense	probably damaging	0.96
R1723:Slc40a1	UTSW	1	45924761	missense	probably damaging	1.00
R1892:Slc40a1	UTSW	1	45911142	nonsense	probably null
R2303:Slc40a1	UTSW	1	45910884	splice site	probably benign
R2365:Slc40a1	UTSW	1	45924713	splice site	probably null
R3718:Slc40a1	UTSW	1	45910991	missense	probably benign
R4689:Slc40a1	UTSW	1	45912313	missense	probably benign	0.00
R4994:Slc40a1	UTSW	1	45909664	missense	probably damaging	1.00
R5103:Slc40a1	UTSW	1	45918995	nonsense	probably null
R5151:Slc40a1	UTSW	1	45911356	missense	possibly damaging	0.84
R5364:Slc40a1	UTSW	1	45925223	missense	probably damaging	0.96
R5404:Slc40a1	UTSW	1	45912328	missense	probably damaging	1.00
R5531:Slc40a1	UTSW	1	45912338	missense	probably damaging	1.00
R5841:Slc40a1	UTSW	1	45912349	missense	probably damaging	1.00
R6440:Slc40a1	UTSW	1	45925262	start codon destroyed	probably null	0.94
R6455:Slc40a1	UTSW	1	45918947	missense	probably damaging	0.99
R6975:Slc40a1	UTSW	1	45909492	missense	probably benign	0.19
R7085:Slc40a1	UTSW	1	45911528	missense	probably benign
R7130:Slc40a1	UTSW	1	45921224	missense	probably damaging	1.00
R7502:Slc40a1	UTSW	1	45918974	missense	probably damaging	1.00
R7755:Slc40a1	UTSW	1	45911306	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAAATAACCATCTTTGCTGGCG -3'
(R):5'- GTGCAGAACTCCATGAACTACC -3'

Sequencing Primer
(F):5'- AGTTAGTGCTCCTAGCCCTTAAGG -3'
(R):5'- GCAGAACTCCATGAACTACCTTCTTG -3'

Posted On

2014-09-18