Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:Zer1'

231810

Institutional Source

Beutler Lab

Gene Symbol

Zer1

Ensembl Gene

ENSMUSG00000039686

Gene Name

zyg-11 related, cell cycle regulator

Synonyms

C230075L19Rik, Zyg11bl

MMRRC Submission

040097-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30097283-30124585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30108274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 342 (L342F)

Ref Sequence

ENSEMBL: ENSMUSP00000046441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]

AlphaFold

Q80ZJ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000044751
AA Change: L342F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: L342F

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	405	774	3e-15	SMART
Blast:ARM	440	480	2e-18	BLAST
Blast:ARM	524	569	4e-24	BLAST
Blast:ARM	571	613	6e-22	BLAST
Blast:ARM	617	656	7e-8	BLAST
Blast:ARM	686	724	6e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000113677
AA Change: L329F

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: L329F

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	392	761	3e-15	SMART
Blast:ARM	427	467	2e-18	BLAST
Blast:ARM	511	556	4e-24	BLAST
Blast:ARM	558	600	2e-21	BLAST
Blast:ARM	604	643	7e-8	BLAST
Blast:ARM	673	711	6e-18	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139128

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149818

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154231

Meta Mutation Damage Score

0.2861

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Zer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01098:Zer1	APN	2	30108220	critical splice donor site	probably null
IGL01630:Zer1	APN	2	30101831	missense	probably damaging	1.00
IGL02126:Zer1	APN	2	30104916	missense	probably benign	0.10
IGL02338:Zer1	APN	2	30113393	missense	probably damaging	1.00
IGL02817:Zer1	APN	2	30103394	missense	probably damaging	0.99
PIT4402001:Zer1	UTSW	2	30101120	missense	probably damaging	0.96
PIT4495001:Zer1	UTSW	2	30103543	missense	probably benign	0.01
R0390:Zer1	UTSW	2	30108213	splice site	probably benign
R0506:Zer1	UTSW	2	30101807	missense	probably damaging	1.00
R0606:Zer1	UTSW	2	30104797	splice site	probably benign
R0928:Zer1	UTSW	2	30101763	critical splice donor site	probably null
R1167:Zer1	UTSW	2	30108246	missense	probably benign	0.00
R1819:Zer1	UTSW	2	30110218	missense	probably benign	0.18
R2040:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2041:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2042:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2168:Zer1	UTSW	2	30104875	missense	probably damaging	1.00
R2243:Zer1	UTSW	2	30101127	missense	probably damaging	0.99
R2254:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2255:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2311:Zer1	UTSW	2	30101822	missense	probably damaging	0.99
R2993:Zer1	UTSW	2	30101897	missense	probably damaging	1.00
R3010:Zer1	UTSW	2	30113285	missense	probably benign	0.13
R3731:Zer1	UTSW	2	30110911	missense	probably benign	0.44
R4038:Zer1	UTSW	2	30107523	missense	probably damaging	1.00
R5241:Zer1	UTSW	2	30104970	missense	probably damaging	1.00
R5433:Zer1	UTSW	2	30100986	intron	probably benign
R5443:Zer1	UTSW	2	30110996	missense	probably damaging	1.00
R5524:Zer1	UTSW	2	30104854	missense	probably damaging	1.00
R5936:Zer1	UTSW	2	30107667	missense	probably damaging	0.97
R5999:Zer1	UTSW	2	30104997	missense	probably damaging	1.00
R6598:Zer1	UTSW	2	30113274	missense	probably damaging	1.00
R6965:Zer1	UTSW	2	30101047	missense	possibly damaging	0.87
R7030:Zer1	UTSW	2	30111021	missense	probably benign	0.00
R7190:Zer1	UTSW	2	30103432	missense	probably damaging	1.00
R7218:Zer1	UTSW	2	30105012	missense	probably damaging	1.00
R7252:Zer1	UTSW	2	30101892	missense	probably damaging	0.99
R7383:Zer1	UTSW	2	30111241	missense	probably damaging	1.00
R7417:Zer1	UTSW	2	30102822	missense	probably damaging	1.00
R7459:Zer1	UTSW	2	30113325	missense	probably damaging	1.00
R7463:Zer1	UTSW	2	30113437	start gained	probably benign
R7466:Zer1	UTSW	2	30101484	splice site	probably null
R7477:Zer1	UTSW	2	30107976	missense	probably null	0.34
R7719:Zer1	UTSW	2	30111231	missense	probably damaging	1.00
R7813:Zer1	UTSW	2	30110373	missense	probably damaging	1.00
R7976:Zer1	UTSW	2	30107508	missense	probably damaging	0.99
R8239:Zer1	UTSW	2	30101135	critical splice acceptor site	probably null
R8350:Zer1	UTSW	2	30101850	missense	probably damaging	1.00
R8404:Zer1	UTSW	2	30105023	critical splice acceptor site	probably null
R8842:Zer1	UTSW	2	30111050	missense	possibly damaging	0.65
R8896:Zer1	UTSW	2	30103418	missense	probably damaging	0.99
R8906:Zer1	UTSW	2	30111023	missense	probably benign	0.31
R8929:Zer1	UTSW	2	30110869	missense	probably damaging	1.00
R9050:Zer1	UTSW	2	30111282	missense	probably damaging	1.00
R9066:Zer1	UTSW	2	30110674	missense	probably damaging	1.00
R9277:Zer1	UTSW	2	30111285	missense	probably benign	0.00
R9322:Zer1	UTSW	2	30110911	missense	probably benign	0.00
X0026:Zer1	UTSW	2	30104895	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGGCCCTGGATGTGATCTC -3'
(R):5'- CAGGGAATGCAGCTCAAGTG -3'

Sequencing Primer
(F):5'- CTGGATGTGATCTCGGGCC -3'
(R):5'- AGAAGCATGTGCCTGTATCC -3'

Posted On

2014-09-18