Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:Dab1'

231820

Institutional Source

Beutler Lab

Gene Symbol

Dab1

Ensembl Gene

ENSMUSG00000028519

Gene Name

disabled 1

Synonyms

C630028C02Rik

MMRRC Submission

040097-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.872) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103619359-104744844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 104678777 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 128 (Y128D)

Ref Sequence

ENSEMBL: ENSMUSP00000102443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106826] [ENSMUST00000106827] [ENSMUST00000106830] [ENSMUST00000143644] [ENSMUST00000146078]

Predicted Effect

probably damaging
Transcript: ENSMUST00000106826
AA Change: Y108D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102439
Gene: ENSMUSG00000028519
AA Change: Y108D

Domain	Start	End	E-Value	Type
PTB	17	151	3.51e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106827
AA Change: Y128D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102440
Gene: ENSMUSG00000028519
AA Change: Y128D

Domain	Start	End	E-Value	Type
PTB	37	171	3.51e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106830
AA Change: Y128D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519
AA Change: Y128D

Domain	Start	End	E-Value	Type
PTB	37	171	3.51e-36	SMART
low complexity region	254	267	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	490	501	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141037

Predicted Effect

possibly damaging
Transcript: ENSMUST00000143644
AA Change: Y128D

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118650
Gene: ENSMUSG00000028519
AA Change: Y128D

Domain	Start	End	E-Value	Type
PTB	37	160	5.54e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146078
AA Change: Y128D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519
AA Change: Y128D

Domain	Start	End	E-Value	Type
PTB	37	171	3.51e-36	SMART
low complexity region	235	242	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000149672
AA Change: Y106D

SMART Domains

Protein: ENSMUSP00000118532
Gene: ENSMUSG00000028519
AA Change: Y106D

Domain	Start	End	E-Value	Type
PTB	16	150	3.51e-36	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Dab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Dab1	APN	4	104678810	missense	probably damaging	1.00
IGL00087:Dab1	APN	4	104678753	missense	possibly damaging	0.90
IGL00328:Dab1	APN	4	104688438	missense	possibly damaging	0.55
IGL00756:Dab1	APN	4	104727878	missense	probably benign
IGL02074:Dab1	APN	4	104727854	missense	possibly damaging	0.90
IGL02286:Dab1	APN	4	104680070	missense	probably damaging	1.00
IGL02986:Dab1	APN	4	104479221	missense	probably benign	0.00
IGL03008:Dab1	APN	4	104727580	missense	probably damaging	0.99
IGL03133:Dab1	APN	4	104727580	missense	probably benign	0.41
IGL03375:Dab1	APN	4	104681601	missense	possibly damaging	0.70
LCD18:Dab1	UTSW	4	104046572	intron	probably benign
R0027:Dab1	UTSW	4	104704199	intron	probably benign
R0466:Dab1	UTSW	4	104720550	missense	probably benign	0.15
R0838:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R0840:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1086:Dab1	UTSW	4	104328572	intron	probably benign
R1598:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1640:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1699:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1749:Dab1	UTSW	4	104328298	intron	probably benign
R1770:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1846:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1847:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1848:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1885:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R1986:Dab1	UTSW	4	104613215	missense	probably damaging	0.97
R1990:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2006:Dab1	UTSW	4	104605325	missense	probably damaging	1.00
R2030:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2032:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2034:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2061:Dab1	UTSW	4	104678741	missense	probably damaging	1.00
R2088:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2089:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2091:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2091:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2193:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2194:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2361:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2362:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2391:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2424:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R2865:Dab1	UTSW	4	104680146	missense	probably benign
R3118:Dab1	UTSW	4	104680069	critical splice acceptor site	probably null
R3716:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3718:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3740:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3742:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R3965:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4057:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4393:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4396:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4418:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4607:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4608:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4648:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4693:Dab1	UTSW	4	104679553	missense	probably damaging	1.00
R4701:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4730:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R4760:Dab1	UTSW	4	104732145	missense	probably damaging	1.00
R4927:Dab1	UTSW	4	104704252	missense	probably benign
R5173:Dab1	UTSW	4	104688448	splice site	probably null
R5503:Dab1	UTSW	4	104512264	missense	probably benign	0.01
R6199:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6200:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6207:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6224:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6227:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6228:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6229:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6246:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6247:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6248:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6249:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6250:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6258:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6259:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6260:Dab1	UTSW	4	104731751	missense	probably benign	0.29
R6505:Dab1	UTSW	4	104512264	missense	probably benign	0.01
R6817:Dab1	UTSW	4	104679546	missense	probably damaging	1.00
R7305:Dab1	UTSW	4	104713790	missense
R7709:Dab1	UTSW	4	104720559	nonsense	probably null
R7894:Dab1	UTSW	4	104732138	missense	probably benign	0.03
R7977:Dab1	UTSW	4	104732138	missense	probably benign	0.03
RF017:Dab1	UTSW	4	104713652	missense	probably benign	0.01
Z1088:Dab1	UTSW	4	104479232	missense	probably damaging	0.99
Z1176:Dab1	UTSW	4	104728078	missense	probably benign	0.00
Z1177:Dab1	UTSW	4	104727740	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TTTTCTCAAGGGCAGGCGTAG -3'
(R):5'- TGCACATCAGCTGACAGTG -3'

Sequencing Primer
(F):5'- TTTCCCAAAGCCCCTTGG -3'
(R):5'- ACAGTGGCGGTCCATCATTTG -3'

Posted On

2014-09-18