Incidental Mutation 'R2092:Dab1'
ID231820
Institutional Source Beutler Lab
Gene Symbol Dab1
Ensembl Gene ENSMUSG00000028519
Gene Namedisabled 1
SynonymsC630028C02Rik
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R2092 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location103619359-104744844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104678777 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 128 (Y128D)
Ref Sequence ENSEMBL: ENSMUSP00000102443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106826] [ENSMUST00000106827] [ENSMUST00000106830] [ENSMUST00000143644] [ENSMUST00000146078]
Predicted Effect probably damaging
Transcript: ENSMUST00000106826
AA Change: Y108D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102439
Gene: ENSMUSG00000028519
AA Change: Y108D

DomainStartEndE-ValueType
PTB 17 151 3.51e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106827
AA Change: Y128D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102440
Gene: ENSMUSG00000028519
AA Change: Y128D

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106830
AA Change: Y128D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519
AA Change: Y128D

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 254 267 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 490 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141037
Predicted Effect possibly damaging
Transcript: ENSMUST00000143644
AA Change: Y128D

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118650
Gene: ENSMUSG00000028519
AA Change: Y128D

DomainStartEndE-ValueType
PTB 37 160 5.54e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146078
AA Change: Y128D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519
AA Change: Y128D

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 235 242 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000149672
AA Change: Y106D
SMART Domains Protein: ENSMUSP00000118532
Gene: ENSMUSG00000028519
AA Change: Y106D

DomainStartEndE-ValueType
PTB 16 150 3.51e-36 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Dab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dab1 APN 4 104678810 missense probably damaging 1.00
IGL00087:Dab1 APN 4 104678753 missense possibly damaging 0.90
IGL00328:Dab1 APN 4 104688438 missense possibly damaging 0.55
IGL00756:Dab1 APN 4 104727878 missense probably benign
IGL02074:Dab1 APN 4 104727854 missense possibly damaging 0.90
IGL02286:Dab1 APN 4 104680070 missense probably damaging 1.00
IGL02986:Dab1 APN 4 104479221 missense probably benign 0.00
IGL03008:Dab1 APN 4 104727580 missense probably damaging 0.99
IGL03133:Dab1 APN 4 104727580 missense probably benign 0.41
IGL03375:Dab1 APN 4 104681601 missense possibly damaging 0.70
LCD18:Dab1 UTSW 4 104046572 intron probably benign
R0027:Dab1 UTSW 4 104704199 intron probably benign
R0466:Dab1 UTSW 4 104720550 missense probably benign 0.15
R0838:Dab1 UTSW 4 104731751 missense probably benign 0.29
R0840:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1086:Dab1 UTSW 4 104328572 intron probably benign
R1598:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1640:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1699:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1749:Dab1 UTSW 4 104328298 intron probably benign
R1770:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1846:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1847:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1848:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1885:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1986:Dab1 UTSW 4 104613215 missense probably damaging 0.97
R1990:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2006:Dab1 UTSW 4 104605325 missense probably damaging 1.00
R2030:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2032:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2034:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2061:Dab1 UTSW 4 104678741 missense probably damaging 1.00
R2088:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2089:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2193:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2194:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2361:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2362:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2391:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2424:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2865:Dab1 UTSW 4 104680146 missense probably benign
R3118:Dab1 UTSW 4 104680069 critical splice acceptor site probably null
R3716:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3718:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3740:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3742:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3965:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4057:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4393:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4396:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4418:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4607:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4608:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4648:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4693:Dab1 UTSW 4 104679553 missense probably damaging 1.00
R4701:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4730:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4760:Dab1 UTSW 4 104732145 missense probably damaging 1.00
R4927:Dab1 UTSW 4 104704252 missense probably benign
R5173:Dab1 UTSW 4 104688448 splice site probably null
R5503:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6199:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6200:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6207:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6224:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6227:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6228:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6229:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6246:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6247:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6248:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6249:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6250:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6258:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6259:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6260:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6505:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6817:Dab1 UTSW 4 104679546 missense probably damaging 1.00
R7305:Dab1 UTSW 4 104713790 missense
R7709:Dab1 UTSW 4 104720559 nonsense probably null
R7894:Dab1 UTSW 4 104732138 missense probably benign 0.03
R7977:Dab1 UTSW 4 104732138 missense probably benign 0.03
RF017:Dab1 UTSW 4 104713652 missense probably benign 0.01
Z1088:Dab1 UTSW 4 104479232 missense probably damaging 0.99
Z1176:Dab1 UTSW 4 104728078 missense probably benign 0.00
Z1177:Dab1 UTSW 4 104727740 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTTTCTCAAGGGCAGGCGTAG -3'
(R):5'- TGCACATCAGCTGACAGTG -3'

Sequencing Primer
(F):5'- TTTCCCAAAGCCCCTTGG -3'
(R):5'- ACAGTGGCGGTCCATCATTTG -3'
Posted On2014-09-18