Incidental Mutation 'R2092:Sh3tc1'
ID 231823
Institutional Source Beutler Lab
Gene Symbol Sh3tc1
Ensembl Gene ENSMUSG00000036553
Gene Name SH3 domain and tetratricopeptide repeats 1
Synonyms
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R2092 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 35697180-35739987 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35700658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1121 (E1121G)
Ref Sequence ENSEMBL: ENSMUSP00000144175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070203] [ENSMUST00000129664] [ENSMUST00000201511]
AlphaFold G3X9F6
Predicted Effect probably damaging
Transcript: ENSMUST00000070203
AA Change: E1121G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070610
Gene: ENSMUSG00000036553
AA Change: E1121G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127288
Predicted Effect unknown
Transcript: ENSMUST00000127825
AA Change: E1059G
SMART Domains Protein: ENSMUSP00000115376
Gene: ENSMUSG00000036553
AA Change: E1059G

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
SH3 251 310 1.72e-6 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
low complexity region 480 491 N/A INTRINSIC
TPR 504 537 3.41e1 SMART
Blast:TPR 546 578 2e-6 BLAST
TPR 607 640 3.37e-2 SMART
TPR 735 768 6.4e1 SMART
Blast:TPR 813 841 2e-6 BLAST
TPR 852 885 9.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129664
SMART Domains Protein: ENSMUSP00000119811
Gene: ENSMUSG00000036553

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
SH3 76 130 2.41e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151555
Predicted Effect probably damaging
Transcript: ENSMUST00000201511
AA Change: E1121G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144175
Gene: ENSMUSG00000036553
AA Change: E1121G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 101 117 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
SH3 312 371 1.72e-6 SMART
low complexity region 381 397 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
TPR 565 598 3.41e1 SMART
Blast:TPR 607 639 2e-6 BLAST
TPR 668 701 3.37e-2 SMART
TPR 796 829 6.4e1 SMART
Blast:TPR 874 902 2e-6 BLAST
TPR 913 946 9.99e1 SMART
TPR 1202 1235 4.31e0 SMART
low complexity region 1266 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Sh3tc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Sh3tc1 APN 5 35710957 missense probably damaging 1.00
IGL01019:Sh3tc1 APN 5 35703375 missense probably damaging 1.00
IGL01725:Sh3tc1 APN 5 35700316 missense probably benign 0.08
IGL02069:Sh3tc1 APN 5 35718995 missense probably benign 0.45
IGL02153:Sh3tc1 APN 5 35703352 missense probably damaging 1.00
IGL02269:Sh3tc1 APN 5 35706284 missense probably benign 0.21
IGL02609:Sh3tc1 APN 5 35707172 missense probably damaging 0.99
IGL02984:Sh3tc1 UTSW 5 35714059 splice site probably null
R0280:Sh3tc1 UTSW 5 35706017 missense probably damaging 1.00
R0305:Sh3tc1 UTSW 5 35723999 missense probably benign
R0322:Sh3tc1 UTSW 5 35706561 missense possibly damaging 0.86
R0485:Sh3tc1 UTSW 5 35702012 splice site probably benign
R0511:Sh3tc1 UTSW 5 35703462 missense probably damaging 1.00
R0513:Sh3tc1 UTSW 5 35700307 missense possibly damaging 0.87
R0523:Sh3tc1 UTSW 5 35724066 small deletion probably benign
R0550:Sh3tc1 UTSW 5 35699784 missense probably damaging 0.99
R0676:Sh3tc1 UTSW 5 35719114 splice site probably benign
R1485:Sh3tc1 UTSW 5 35719026 missense probably benign 0.00
R1559:Sh3tc1 UTSW 5 35703349 critical splice donor site probably null
R1599:Sh3tc1 UTSW 5 35707512 missense probably benign 0.05
R1759:Sh3tc1 UTSW 5 35705904 missense possibly damaging 0.95
R1808:Sh3tc1 UTSW 5 35705924 missense probably benign 0.01
R1816:Sh3tc1 UTSW 5 35700584 critical splice donor site probably null
R2036:Sh3tc1 UTSW 5 35716164 missense probably benign 0.01
R2944:Sh3tc1 UTSW 5 35714160 missense probably damaging 1.00
R4258:Sh3tc1 UTSW 5 35706978 missense probably benign 0.00
R4556:Sh3tc1 UTSW 5 35707082 missense probably damaging 1.00
R4647:Sh3tc1 UTSW 5 35706318 missense probably damaging 1.00
R5011:Sh3tc1 UTSW 5 35700289 missense probably damaging 1.00
R5740:Sh3tc1 UTSW 5 35707055 missense probably benign 0.00
R6023:Sh3tc1 UTSW 5 35706951 nonsense probably null
R6164:Sh3tc1 UTSW 5 35706246 missense probably benign 0.05
R6262:Sh3tc1 UTSW 5 35699773 missense probably damaging 1.00
R6433:Sh3tc1 UTSW 5 35706597 missense probably damaging 0.99
R6932:Sh3tc1 UTSW 5 35707434 missense probably benign 0.01
R6986:Sh3tc1 UTSW 5 35723944 missense probably benign
R7098:Sh3tc1 UTSW 5 35702014 splice site probably null
R7502:Sh3tc1 UTSW 5 35706062 missense probably damaging 0.96
R7737:Sh3tc1 UTSW 5 35723953 missense probably benign 0.15
R7792:Sh3tc1 UTSW 5 35710951 missense probably damaging 0.97
R8079:Sh3tc1 UTSW 5 35706857 missense possibly damaging 0.78
R8154:Sh3tc1 UTSW 5 35718352 missense probably damaging 1.00
R8267:Sh3tc1 UTSW 5 35706407 missense probably benign 0.01
R8300:Sh3tc1 UTSW 5 35697448 missense probably benign 0.00
R8416:Sh3tc1 UTSW 5 35710912 missense probably damaging 0.99
R8459:Sh3tc1 UTSW 5 35721589 missense probably benign
R8699:Sh3tc1 UTSW 5 35701891 missense probably damaging 1.00
R8754:Sh3tc1 UTSW 5 35706458 missense probably benign 0.07
R8782:Sh3tc1 UTSW 5 35714204 missense possibly damaging 0.93
R9044:Sh3tc1 UTSW 5 35697490 missense possibly damaging 0.84
R9047:Sh3tc1 UTSW 5 35706483 missense probably benign
R9092:Sh3tc1 UTSW 5 35716977 missense probably benign 0.00
X0061:Sh3tc1 UTSW 5 35706809 missense probably damaging 1.00
Z1176:Sh3tc1 UTSW 5 35714229 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTCCTAAGCCCACATGTGTG -3'
(R):5'- CTAGCTCTCTGGTCCTGAAAGC -3'

Sequencing Primer
(F):5'- ACATGTGTGTGAGGAACTGTCAC -3'
(R):5'- TGAAAGCTCCTCTCCTCAGAG -3'
Posted On 2014-09-18