Incidental Mutation 'R2092:Otop1'
ID 231824
Institutional Source Beutler Lab
Gene Symbol Otop1
Ensembl Gene ENSMUSG00000051596
Gene Name otopetrin 1
Synonyms tlt, A530025J20Rik
MMRRC Submission 040097-MU
Accession Numbers

NCBI RefSeq: NM_172709.3; MGI:2388363

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R2092 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 38275972-38304217 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38299766 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 290 (I290F)
Ref Sequence ENSEMBL: ENSMUSP00000109734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063136] [ENSMUST00000114099]
AlphaFold Q80VM9
Predicted Effect probably damaging
Transcript: ENSMUST00000063136
AA Change: I287F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061805
Gene: ENSMUSG00000051596
AA Change: I287F

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 87 106 N/A INTRINSIC
Pfam:Otopetrin 127 239 1.6e-13 PFAM
Pfam:Otopetrin 240 456 1.9e-16 PFAM
low complexity region 462 471 N/A INTRINSIC
Pfam:Otopetrin 518 583 3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114099
AA Change: I290F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109734
Gene: ENSMUSG00000051596
AA Change: I290F

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
Pfam:Otopetrin 130 457 3.1e-40 PFAM
low complexity region 466 475 N/A INTRINSIC
Pfam:Otopetrin 513 587 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187863
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 4881519; 2655558; 1856638; 4950042
PHENOTYPE: Homozygous mutant mice display vestibular abnormalities associated with absent otoconia. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Spontaneous(1) Chemically induced(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Otop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Otop1 APN 5 38302845 missense probably damaging 1.00
IGL01793:Otop1 APN 5 38299871 missense possibly damaging 0.89
IGL02071:Otop1 APN 5 38287983 missense probably damaging 1.00
IGL02111:Otop1 APN 5 38277701 missense probably benign 0.01
IGL02660:Otop1 APN 5 38288005 missense probably damaging 0.99
IGL02672:Otop1 APN 5 38277826 critical splice donor site probably null
IGL03164:Otop1 APN 5 38287962 nonsense probably null
BB008:Otop1 UTSW 5 38288020 missense probably damaging 1.00
BB018:Otop1 UTSW 5 38288020 missense probably damaging 1.00
P0015:Otop1 UTSW 5 38294559 splice site probably benign
R0092:Otop1 UTSW 5 38299830 missense probably damaging 0.97
R0639:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0670:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R0673:Otop1 UTSW 5 38287948 missense possibly damaging 0.77
R2105:Otop1 UTSW 5 38300458 missense probably benign
R2152:Otop1 UTSW 5 38302851 missense probably damaging 1.00
R3971:Otop1 UTSW 5 38300189 missense probably benign 0.04
R3972:Otop1 UTSW 5 38300189 missense probably benign 0.04
R4575:Otop1 UTSW 5 38299721 missense probably damaging 1.00
R4660:Otop1 UTSW 5 38300024 missense possibly damaging 0.95
R4998:Otop1 UTSW 5 38294548 critical splice donor site probably null
R5412:Otop1 UTSW 5 38297984 missense probably benign 0.25
R5461:Otop1 UTSW 5 38299715 missense probably damaging 1.00
R5607:Otop1 UTSW 5 38294504 missense possibly damaging 0.68
R5625:Otop1 UTSW 5 38302761 missense probably damaging 1.00
R5677:Otop1 UTSW 5 38300163 missense probably damaging 1.00
R5792:Otop1 UTSW 5 38297916 missense probably benign 0.04
R5878:Otop1 UTSW 5 38277822 missense possibly damaging 0.73
R6163:Otop1 UTSW 5 38287890 splice site probably null
R7338:Otop1 UTSW 5 38300203 nonsense probably null
R7931:Otop1 UTSW 5 38288020 missense probably damaging 1.00
R7994:Otop1 UTSW 5 38299851 missense probably benign 0.02
R8224:Otop1 UTSW 5 38300503 missense possibly damaging 0.79
R8733:Otop1 UTSW 5 38299773 missense probably damaging 1.00
R8733:Otop1 UTSW 5 38300453 nonsense probably null
R8987:Otop1 UTSW 5 38299727 missense probably damaging 1.00
R9192:Otop1 UTSW 5 38287930 missense probably benign 0.25
R9278:Otop1 UTSW 5 38302815 missense probably damaging 1.00
R9290:Otop1 UTSW 5 38297958 missense probably benign 0.06
X0064:Otop1 UTSW 5 38299751 missense probably damaging 1.00
Z1177:Otop1 UTSW 5 38277770 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGAGAGGTCCAAGCTGATG -3'
(R):5'- GAACATGATGAGAGCCGACTC -3'

Sequencing Primer
(F):5'- AGCTGATGGGCTTGTTAGTCTCC -3'
(R):5'- ACTCGCTCTTGGATTTGGAGC -3'
Posted On 2014-09-18