Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:Bod1l'

231825

Institutional Source

Beutler Lab

Gene Symbol

Bod1l

Ensembl Gene

ENSMUSG00000061755

Gene Name

biorientation of chromosomes in cell division 1-like

Synonyms

A230054D04Rik

MMRRC Submission

040097-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41787538-41844315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41831517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 416 (S416P)

Ref Sequence

ENSEMBL: ENSMUSP00000144359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000050556
AA Change: S416P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: S416P

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	1.8e-28	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	3.21e-1	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202200

Predicted Effect

probably damaging
Transcript: ENSMUST00000202908
AA Change: S416P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: S416P

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	2.9e-24	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	1.9e-3	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Bod1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Bod1l	APN	5	41816823	missense	probably benign	0.00
IGL00990:Bod1l	APN	5	41828865	missense	probably benign	0.00
IGL01021:Bod1l	APN	5	41838173	splice site	probably benign
IGL01022:Bod1l	APN	5	41794309	missense	probably damaging	1.00
IGL01303:Bod1l	APN	5	41817599	missense	probably benign	0.00
IGL01654:Bod1l	APN	5	41818176	missense	probably damaging	0.99
IGL01748:Bod1l	APN	5	41816961	missense	probably benign	0.23
IGL01758:Bod1l	APN	5	41826610	splice site	probably benign
IGL01783:Bod1l	APN	5	41808712	missense	probably benign	0.02
IGL01790:Bod1l	APN	5	41832250	missense	probably benign	0.14
IGL01803:Bod1l	APN	5	41817389	missense	probably damaging	0.97
IGL01829:Bod1l	APN	5	41820468	missense	probably benign	0.25
IGL01952:Bod1l	APN	5	41816954	missense	possibly damaging	0.70
IGL02005:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02110:Bod1l	APN	5	41816453	missense	probably damaging	0.97
IGL02129:Bod1l	APN	5	41821850	missense	probably benign	0.36
IGL02572:Bod1l	APN	5	41821230	nonsense	probably null
IGL02583:Bod1l	APN	5	41816207	critical splice donor site	probably null
IGL02643:Bod1l	APN	5	41818805	missense	possibly damaging	0.65
IGL02714:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02728:Bod1l	APN	5	41826503	missense	probably damaging	1.00
IGL02752:Bod1l	APN	5	41816463	missense	possibly damaging	0.58
IGL02822:Bod1l	APN	5	41794345	missense	possibly damaging	0.94
IGL03032:Bod1l	APN	5	41831584	missense	probably benign	0.16
IGL03372:Bod1l	APN	5	41805235	splice site	probably benign
gauss	UTSW	5	41816867	missense	probably benign	0.01
Tesla	UTSW	5	41795068	critical splice donor site	probably null
R0102:Bod1l	UTSW	5	41817269	missense	probably benign	0.36
R0147:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0148:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0490:Bod1l	UTSW	5	41821892	missense	probably damaging	0.96
R0577:Bod1l	UTSW	5	41794887	missense	probably damaging	1.00
R0587:Bod1l	UTSW	5	41821637	missense	probably benign	0.16
R0620:Bod1l	UTSW	5	41801233	missense	probably benign	0.16
R0626:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R0785:Bod1l	UTSW	5	41820016	missense	probably benign	0.00
R1139:Bod1l	UTSW	5	41831471	missense	possibly damaging	0.64
R1165:Bod1l	UTSW	5	41821053	missense	probably benign	0.02
R1418:Bod1l	UTSW	5	41819471	missense	probably damaging	1.00
R1509:Bod1l	UTSW	5	41819540	missense	probably damaging	0.99
R1533:Bod1l	UTSW	5	41822155	nonsense	probably null
R1538:Bod1l	UTSW	5	41816429	missense	probably benign	0.00
R1591:Bod1l	UTSW	5	41819220	missense	probably benign	0.06
R1616:Bod1l	UTSW	5	41808715	missense	probably benign
R1628:Bod1l	UTSW	5	41816982	missense	probably benign	0.01
R1667:Bod1l	UTSW	5	41816775	missense	probably benign	0.01
R1869:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1870:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1993:Bod1l	UTSW	5	41817336	missense	probably damaging	1.00
R2060:Bod1l	UTSW	5	41808742	missense	possibly damaging	0.58
R2066:Bod1l	UTSW	5	41805156	missense	probably damaging	0.99
R2067:Bod1l	UTSW	5	41817086	missense	probably benign	0.11
R2073:Bod1l	UTSW	5	41819189	missense	probably benign	0.19
R2105:Bod1l	UTSW	5	41832279	missense	probably benign	0.00
R2243:Bod1l	UTSW	5	41821545	missense	possibly damaging	0.58
R2322:Bod1l	UTSW	5	41827120	missense	probably benign	0.09
R2849:Bod1l	UTSW	5	41838076	missense	probably damaging	1.00
R2883:Bod1l	UTSW	5	41832259	missense	probably benign	0.03
R3037:Bod1l	UTSW	5	41822037	missense	probably damaging	0.99
R3910:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3911:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3962:Bod1l	UTSW	5	41808721	missense	probably benign	0.07
R4235:Bod1l	UTSW	5	41821455	missense	probably damaging	1.00
R4308:Bod1l	UTSW	5	41791813	missense	possibly damaging	0.91
R4414:Bod1l	UTSW	5	41820527	missense	probably benign	0.04
R4535:Bod1l	UTSW	5	41832231	missense	probably benign	0.06
R4631:Bod1l	UTSW	5	41817735	missense	probably damaging	1.00
R4657:Bod1l	UTSW	5	41818612	missense	probably benign	0.00
R4782:Bod1l	UTSW	5	41833663	missense	probably benign	0.06
R4786:Bod1l	UTSW	5	41819438	missense	probably benign	0.43
R4840:Bod1l	UTSW	5	41818472	missense	probably damaging	1.00
R4877:Bod1l	UTSW	5	41819994	missense	probably benign	0.00
R4982:Bod1l	UTSW	5	41820473	missense	probably benign	0.00
R5152:Bod1l	UTSW	5	41816543	missense	probably benign	0.04
R5284:Bod1l	UTSW	5	41820467	missense	probably benign	0.05
R5354:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R5369:Bod1l	UTSW	5	41827183	missense	probably damaging	1.00
R5486:Bod1l	UTSW	5	41807181	missense	possibly damaging	0.56
R5541:Bod1l	UTSW	5	41791933	missense	probably benign	0.06
R5610:Bod1l	UTSW	5	41821874	missense	probably damaging	1.00
R5655:Bod1l	UTSW	5	41817044	missense	probably benign	0.06
R5705:Bod1l	UTSW	5	41817002	missense	probably benign	0.01
R5819:Bod1l	UTSW	5	41832605	missense	probably benign	0.27
R5890:Bod1l	UTSW	5	41820578	missense	probably benign	0.43
R5923:Bod1l	UTSW	5	41817419	missense	probably damaging	1.00
R5991:Bod1l	UTSW	5	41816863	nonsense	probably null
R6017:Bod1l	UTSW	5	41818760	missense	probably benign	0.01
R6253:Bod1l	UTSW	5	41826538	missense	probably damaging	0.96
R6284:Bod1l	UTSW	5	41818787	missense	probably benign	0.35
R6483:Bod1l	UTSW	5	41821082	missense	probably benign	0.03
R6485:Bod1l	UTSW	5	41817116	missense	possibly damaging	0.93
R6575:Bod1l	UTSW	5	41838068	missense	probably damaging	1.00
R6679:Bod1l	UTSW	5	41816666	missense	probably damaging	0.97
R6788:Bod1l	UTSW	5	41821873	nonsense	probably null
R7006:Bod1l	UTSW	5	41832552	missense	probably damaging	1.00
R7095:Bod1l	UTSW	5	41795068	critical splice donor site	probably null
R7111:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7190:Bod1l	UTSW	5	41819938	missense	probably benign	0.14
R7311:Bod1l	UTSW	5	41794333	missense	possibly damaging	0.57
R7336:Bod1l	UTSW	5	41821524	missense	probably damaging	1.00
R7341:Bod1l	UTSW	5	41788857	missense	probably benign	0.00
R7396:Bod1l	UTSW	5	41831546	missense	probably damaging	1.00
R7431:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7442:Bod1l	UTSW	5	41807179	missense	probably damaging	0.96
R7539:Bod1l	UTSW	5	41817860	missense	possibly damaging	0.65
R7583:Bod1l	UTSW	5	41833790	missense	probably damaging	1.00
R7679:Bod1l	UTSW	5	41820643	frame shift	probably null
R7748:Bod1l	UTSW	5	41832340	missense	probably damaging	0.97
R7767:Bod1l	UTSW	5	41816756	missense	probably benign	0.01
R7773:Bod1l	UTSW	5	41832712	missense	probably benign	0.14
R7782:Bod1l	UTSW	5	41817943	missense	probably benign	0.01
R7860:Bod1l	UTSW	5	41819265	missense	probably damaging	1.00
R7975:Bod1l	UTSW	5	41816277	missense	possibly damaging	0.90
R7977:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R7987:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R8104:Bod1l	UTSW	5	41833732	nonsense	probably null
R8217:Bod1l	UTSW	5	41831507	missense	probably damaging	1.00
R8307:Bod1l	UTSW	5	41821155	missense	probably damaging	1.00
R8469:Bod1l	UTSW	5	41821491	missense	possibly damaging	0.86
R8506:Bod1l	UTSW	5	41819055	nonsense	probably null
R8934:Bod1l	UTSW	5	41819601	missense	probably benign	0.11
R8984:Bod1l	UTSW	5	41788872	missense	probably damaging	1.00
R8989:Bod1l	UTSW	5	41821682	missense	probably benign	0.00
R8993:Bod1l	UTSW	5	41816867	missense	probably benign	0.01
R9128:Bod1l	UTSW	5	41788923	missense	probably benign	0.22
R9129:Bod1l	UTSW	5	41818877	missense	probably damaging	0.99
R9198:Bod1l	UTSW	5	41799786	missense	probably benign	0.08
R9254:Bod1l	UTSW	5	41821880	missense	probably damaging	1.00
X0027:Bod1l	UTSW	5	41832669	missense	probably benign	0.20
X0058:Bod1l	UTSW	5	41824018	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41821146	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41808764	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAGACTCTAGCTATACCATAGTCAGG -3'
(R):5'- TTTCACACTGTTCCAAGCAAC -3'

Sequencing Primer
(F):5'- GCTATACCATAGTCAGGAAGTAGCC -3'
(R):5'- CACACTGTTCCAAGCAACTTAAATTG -3'

Posted On

2014-09-18