Incidental Mutation 'R2092:Bod1l'
ID231825
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Namebiorientation of chromosomes in cell division 1-like
SynonymsA230054D04Rik
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R2092 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location41787538-41844315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41831517 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 416 (S416P)
Ref Sequence ENSEMBL: ENSMUSP00000144359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
Predicted Effect probably damaging
Transcript: ENSMUST00000050556
AA Change: S416P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: S416P

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202200
Predicted Effect probably damaging
Transcript: ENSMUST00000202908
AA Change: S416P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: S416P

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41816823 missense probably benign 0.00
IGL00990:Bod1l APN 5 41828865 missense probably benign 0.00
IGL01021:Bod1l APN 5 41838173 splice site probably benign
IGL01022:Bod1l APN 5 41794309 missense probably damaging 1.00
IGL01303:Bod1l APN 5 41817599 missense probably benign 0.00
IGL01654:Bod1l APN 5 41818176 missense probably damaging 0.99
IGL01748:Bod1l APN 5 41816961 missense probably benign 0.23
IGL01758:Bod1l APN 5 41826610 splice site probably benign
IGL01783:Bod1l APN 5 41808712 missense probably benign 0.02
IGL01790:Bod1l APN 5 41832250 missense probably benign 0.14
IGL01803:Bod1l APN 5 41817389 missense probably damaging 0.97
IGL01829:Bod1l APN 5 41820468 missense probably benign 0.25
IGL01952:Bod1l APN 5 41816954 missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02110:Bod1l APN 5 41816453 missense probably damaging 0.97
IGL02129:Bod1l APN 5 41821850 missense probably benign 0.36
IGL02572:Bod1l APN 5 41821230 nonsense probably null
IGL02583:Bod1l APN 5 41816207 critical splice donor site probably null
IGL02643:Bod1l APN 5 41818805 missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41816339 missense probably benign 0.01
IGL02728:Bod1l APN 5 41826503 missense probably damaging 1.00
IGL02752:Bod1l APN 5 41816463 missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41794345 missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41831584 missense probably benign 0.16
IGL03372:Bod1l APN 5 41805235 splice site probably benign
R0102:Bod1l UTSW 5 41817269 missense probably benign 0.36
R0147:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41818697 missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41821892 missense probably damaging 0.96
R0577:Bod1l UTSW 5 41794887 missense probably damaging 1.00
R0587:Bod1l UTSW 5 41821637 missense probably benign 0.16
R0620:Bod1l UTSW 5 41801233 missense probably benign 0.16
R0626:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R0785:Bod1l UTSW 5 41820016 missense probably benign 0.00
R1139:Bod1l UTSW 5 41831471 missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41821053 missense probably benign 0.02
R1418:Bod1l UTSW 5 41819471 missense probably damaging 1.00
R1509:Bod1l UTSW 5 41819540 missense probably damaging 0.99
R1533:Bod1l UTSW 5 41822155 nonsense probably null
R1538:Bod1l UTSW 5 41816429 missense probably benign 0.00
R1591:Bod1l UTSW 5 41819220 missense probably benign 0.06
R1616:Bod1l UTSW 5 41808715 missense probably benign
R1628:Bod1l UTSW 5 41816982 missense probably benign 0.01
R1667:Bod1l UTSW 5 41816775 missense probably benign 0.01
R1869:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41833675 missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41817336 missense probably damaging 1.00
R2060:Bod1l UTSW 5 41808742 missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41805156 missense probably damaging 0.99
R2067:Bod1l UTSW 5 41817086 missense probably benign 0.11
R2073:Bod1l UTSW 5 41819189 missense probably benign 0.19
R2105:Bod1l UTSW 5 41832279 missense probably benign 0.00
R2243:Bod1l UTSW 5 41821545 missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41827120 missense probably benign 0.09
R2849:Bod1l UTSW 5 41838076 missense probably damaging 1.00
R2883:Bod1l UTSW 5 41832259 missense probably benign 0.03
R3037:Bod1l UTSW 5 41822037 missense probably damaging 0.99
R3910:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3911:Bod1l UTSW 5 41817098 missense probably damaging 0.99
R3962:Bod1l UTSW 5 41808721 missense probably benign 0.07
R4235:Bod1l UTSW 5 41821455 missense probably damaging 1.00
R4308:Bod1l UTSW 5 41791813 missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41820527 missense probably benign 0.04
R4535:Bod1l UTSW 5 41832231 missense probably benign 0.06
R4631:Bod1l UTSW 5 41817735 missense probably damaging 1.00
R4657:Bod1l UTSW 5 41818612 missense probably benign 0.00
R4782:Bod1l UTSW 5 41833663 missense probably benign 0.06
R4786:Bod1l UTSW 5 41819438 missense probably benign 0.43
R4840:Bod1l UTSW 5 41818472 missense probably damaging 1.00
R4877:Bod1l UTSW 5 41819994 missense probably benign 0.00
R4982:Bod1l UTSW 5 41820473 missense probably benign 0.00
R5152:Bod1l UTSW 5 41816543 missense probably benign 0.04
R5284:Bod1l UTSW 5 41820467 missense probably benign 0.05
R5354:Bod1l UTSW 5 41831537 missense probably damaging 1.00
R5369:Bod1l UTSW 5 41827183 missense probably damaging 1.00
R5486:Bod1l UTSW 5 41807181 missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41791933 missense probably benign 0.06
R5610:Bod1l UTSW 5 41821874 missense probably damaging 1.00
R5655:Bod1l UTSW 5 41817044 missense probably benign 0.06
R5705:Bod1l UTSW 5 41817002 missense probably benign 0.01
R5819:Bod1l UTSW 5 41832605 missense probably benign 0.27
R5890:Bod1l UTSW 5 41820578 missense probably benign 0.43
R5923:Bod1l UTSW 5 41817419 missense probably damaging 1.00
R5991:Bod1l UTSW 5 41816863 nonsense probably null
R6017:Bod1l UTSW 5 41818760 missense probably benign 0.01
R6253:Bod1l UTSW 5 41826538 missense probably damaging 0.96
R6284:Bod1l UTSW 5 41818787 missense probably benign 0.35
R6483:Bod1l UTSW 5 41821082 missense probably benign 0.03
R6485:Bod1l UTSW 5 41817116 missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41838068 missense probably damaging 1.00
R6679:Bod1l UTSW 5 41816666 missense probably damaging 0.97
R6788:Bod1l UTSW 5 41821873 nonsense probably null
R7006:Bod1l UTSW 5 41832552 missense probably damaging 1.00
R7095:Bod1l UTSW 5 41795068 critical splice donor site probably null
R7111:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7190:Bod1l UTSW 5 41819938 missense probably benign 0.14
R7311:Bod1l UTSW 5 41794333 missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41821524 missense probably damaging 1.00
R7341:Bod1l UTSW 5 41788857 missense probably benign 0.00
R7396:Bod1l UTSW 5 41831546 missense probably damaging 1.00
R7431:Bod1l UTSW 5 41813120 critical splice donor site probably null
R7442:Bod1l UTSW 5 41807179 missense probably damaging 0.96
R7539:Bod1l UTSW 5 41817860 missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41833790 missense probably damaging 1.00
R7679:Bod1l UTSW 5 41820643 frame shift probably null
R7748:Bod1l UTSW 5 41832340 missense probably damaging 0.97
R7767:Bod1l UTSW 5 41816756 missense probably benign 0.01
R7773:Bod1l UTSW 5 41832712 missense probably benign 0.14
R7782:Bod1l UTSW 5 41817943 missense probably benign 0.01
R7860:Bod1l UTSW 5 41819265 missense probably damaging 1.00
R7943:Bod1l UTSW 5 41819265 missense probably damaging 1.00
R8104:Bod1l UTSW 5 41833732 nonsense probably null
R8217:Bod1l UTSW 5 41831507 missense probably damaging 1.00
R8307:Bod1l UTSW 5 41821155 missense probably damaging 1.00
X0027:Bod1l UTSW 5 41832669 missense probably benign 0.20
X0058:Bod1l UTSW 5 41824018 missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41808764 missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41821146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTCTAGCTATACCATAGTCAGG -3'
(R):5'- TTTCACACTGTTCCAAGCAAC -3'

Sequencing Primer
(F):5'- GCTATACCATAGTCAGGAAGTAGCC -3'
(R):5'- CACACTGTTCCAAGCAACTTAAATTG -3'
Posted On2014-09-18