Incidental Mutation 'R2092:Slc29a4'
ID231828
Institutional Source Beutler Lab
Gene Symbol Slc29a4
Ensembl Gene ENSMUSG00000050822
Gene Namesolute carrier family 29 (nucleoside transporters), member 4
SynonymsmPMAT, ENT4
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2092 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location142692512-142722490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142718855 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 384 (I384N)
Ref Sequence ENSEMBL: ENSMUSP00000059896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058418]
Predicted Effect probably damaging
Transcript: ENSMUST00000058418
AA Change: I384N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059896
Gene: ENSMUSG00000050822
AA Change: I384N

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Nucleoside_tran 170 501 2e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC29A/ENT transporter protein family. The encoded membrane protein catalyzes the reuptake of monoamines into presynaptic neurons, thus determining the intensity and duration of monoamine neural signaling. It has been shown to transport several compounds, including serotonin, dopamine, and the neurotoxin 1-methyl-4-phenylpyridinium. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic cation and monoamine uptake in the choroid plexus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Slc29a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Slc29a4 APN 5 142705530 missense probably benign 0.02
IGL01717:Slc29a4 APN 5 142718746 missense probably damaging 1.00
IGL02184:Slc29a4 APN 5 142717751 missense probably damaging 1.00
IGL02207:Slc29a4 APN 5 142718885 missense possibly damaging 0.76
IGL02210:Slc29a4 APN 5 142718779 missense probably damaging 1.00
IGL02323:Slc29a4 APN 5 142717652 missense probably damaging 0.99
IGL02381:Slc29a4 APN 5 142720099 missense probably benign 0.34
IGL03103:Slc29a4 APN 5 142712080 missense probably damaging 1.00
IGL03210:Slc29a4 APN 5 142715108 missense probably damaging 1.00
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0131:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0132:Slc29a4 UTSW 5 142705530 missense probably benign 0.02
R0850:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R1777:Slc29a4 UTSW 5 142714062 missense probably damaging 0.96
R1864:Slc29a4 UTSW 5 142717754 missense probably damaging 1.00
R1870:Slc29a4 UTSW 5 142721488 makesense probably null
R1871:Slc29a4 UTSW 5 142721488 makesense probably null
R2196:Slc29a4 UTSW 5 142712895 missense possibly damaging 0.94
R4716:Slc29a4 UTSW 5 142718572 missense probably benign 0.00
R5002:Slc29a4 UTSW 5 142718746 missense probably damaging 1.00
R5162:Slc29a4 UTSW 5 142721452 missense possibly damaging 0.80
R5235:Slc29a4 UTSW 5 142718768 missense probably damaging 1.00
R5553:Slc29a4 UTSW 5 142720036 missense probably damaging 1.00
R5642:Slc29a4 UTSW 5 142711972 missense probably damaging 1.00
R5688:Slc29a4 UTSW 5 142714098 missense possibly damaging 0.68
R5930:Slc29a4 UTSW 5 142721402 missense possibly damaging 0.90
R5944:Slc29a4 UTSW 5 142718818 missense probably damaging 1.00
R6056:Slc29a4 UTSW 5 142720077 missense probably damaging 0.99
R6409:Slc29a4 UTSW 5 142712071 missense probably damaging 1.00
R6934:Slc29a4 UTSW 5 142712958 missense probably benign 0.02
R7508:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7509:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7716:Slc29a4 UTSW 5 142718506 missense probably benign 0.00
R7910:Slc29a4 UTSW 5 142705401 missense probably benign 0.00
R7991:Slc29a4 UTSW 5 142705401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCGCCAGCCTCTAACATTC -3'
(R):5'- CCTGAAGCACAGTTGATACCAGAG -3'

Sequencing Primer
(F):5'- GCCAGCCTCTAACATTCCTCAC -3'
(R):5'- GCACAGTTGATACCAGAGAGACC -3'
Posted On2014-09-18