Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:A2m'

231830

Institutional Source

Beutler Lab

Gene Symbol

A2m

Ensembl Gene

ENSMUSG00000030111

Gene Name

alpha-2-macroglobulin

Synonyms

A2mp

MMRRC Submission

040097-MU

Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121635376-121679227 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 121674937 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1321 (C1321*)

Ref Sequence

ENSEMBL: ENSMUSP00000032203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032203]

AlphaFold

Q6GQT1

Predicted Effect

probably null
Transcript: ENSMUST00000032203
AA Change: C1321*

SMART Domains

Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: C1321*

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:A2M_N	134	227	2.1e-20	PFAM
low complexity region	334	347	N/A	INTRINSIC
A2M_N_2	465	613	2.04e-31	SMART
low complexity region	722	731	N/A	INTRINSIC
A2M	738	828	2.31e-39	SMART
Pfam:Thiol-ester_cl	961	990	4.4e-18	PFAM
Pfam:A2M_comp	1010	1266	1.4e-98	PFAM
A2M_recep	1376	1463	2.69e-40	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in A2m

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:A2m	APN	6	121644149	missense	possibly damaging	0.67
IGL00798:A2m	APN	6	121671010	missense	probably damaging	1.00
IGL01154:A2m	APN	6	121673542	nonsense	probably null
IGL01313:A2m	APN	6	121645010	critical splice donor site	probably null
IGL01337:A2m	APN	6	121668570	missense	probably damaging	0.98
IGL01505:A2m	APN	6	121676947	missense	possibly damaging	0.83
IGL01508:A2m	APN	6	121659367	nonsense	probably null
IGL01672:A2m	APN	6	121641357	missense	probably damaging	1.00
IGL01951:A2m	APN	6	121667190	missense	possibly damaging	0.78
IGL02012:A2m	APN	6	121674861	missense	probably damaging	1.00
IGL02066:A2m	APN	6	121649895	missense	probably damaging	1.00
IGL02234:A2m	APN	6	121668220	missense	possibly damaging	0.67
IGL02397:A2m	APN	6	121646875	missense	probably benign
IGL02407:A2m	APN	6	121668616	nonsense	probably null
IGL02408:A2m	APN	6	121644171	missense	probably damaging	0.99
IGL02469:A2m	APN	6	121668115	missense	probably damaging	1.00
IGL02527:A2m	APN	6	121661433	missense	probably damaging	0.99
IGL02612:A2m	APN	6	121678012	missense	probably benign
IGL02746:A2m	APN	6	121669503	splice site	probably benign
IGL02952:A2m	APN	6	121678025	missense	probably damaging	0.99
IGL03056:A2m	APN	6	121670903	missense	probably damaging	0.96
IGL03121:A2m	APN	6	121641306	missense	probably benign	0.02
IGL03303:A2m	APN	6	121667163	missense	probably damaging	1.00
IGL03369:A2m	APN	6	121676903	critical splice acceptor site	probably null
IGL03046:A2m	UTSW	6	121659323	missense	probably benign	0.04
R0040:A2m	UTSW	6	121645206	missense	possibly damaging	0.93
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0109:A2m	UTSW	6	121659303	missense	probably benign	0.00
R0147:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0148:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0345:A2m	UTSW	6	121638272	splice site	probably benign
R0445:A2m	UTSW	6	121657955	missense	probably damaging	1.00
R0766:A2m	UTSW	6	121676890	splice site	probably benign
R1186:A2m	UTSW	6	121661534	missense	probably benign	0.00
R1436:A2m	UTSW	6	121644213	missense	probably benign	0.09
R1452:A2m	UTSW	6	121678056	missense	probably benign	0.01
R1636:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1637:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1638:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1698:A2m	UTSW	6	121645158	missense	possibly damaging	0.88
R1776:A2m	UTSW	6	121641424	missense	probably damaging	1.00
R1791:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1918:A2m	UTSW	6	121644936	missense	probably benign	0.16
R1921:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1927:A2m	UTSW	6	121636379	missense	probably damaging	1.00
R1934:A2m	UTSW	6	121649833	missense	probably damaging	0.98
R1943:A2m	UTSW	6	121668547	missense	possibly damaging	0.90
R1996:A2m	UTSW	6	121669597	missense	probably damaging	1.00
R2039:A2m	UTSW	6	121659949	missense	probably benign	0.32
R2085:A2m	UTSW	6	121676959	missense	probably damaging	1.00
R2105:A2m	UTSW	6	121673500	missense	probably benign	0.04
R2107:A2m	UTSW	6	121654612	missense	probably benign	0.04
R2235:A2m	UTSW	6	121642064	missense	probably benign	0.21
R2292:A2m	UTSW	6	121673559	missense	possibly damaging	0.90
R2350:A2m	UTSW	6	121678088	splice site	probably benign
R3001:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3002:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3023:A2m	UTSW	6	121669572	missense	probably benign	0.08
R3429:A2m	UTSW	6	121636290	start codon destroyed	probably null
R3437:A2m	UTSW	6	121639294	missense	probably null	0.03
R3909:A2m	UTSW	6	121648166	missense	probably damaging	1.00
R4300:A2m	UTSW	6	121673475	missense	probably benign	0.00
R4332:A2m	UTSW	6	121657447	missense	probably benign	0.01
R4584:A2m	UTSW	6	121657406	missense	probably benign	0.07
R4697:A2m	UTSW	6	121638284	start codon destroyed	probably null	0.94
R4710:A2m	UTSW	6	121641303	missense	probably benign	0.03
R4841:A2m	UTSW	6	121646844	missense	probably benign	0.06
R5206:A2m	UTSW	6	121674807	missense	probably damaging	1.00
R5219:A2m	UTSW	6	121676950	missense	possibly damaging	0.90
R5230:A2m	UTSW	6	121674861	missense	probably damaging	1.00
R5330:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5331:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5377:A2m	UTSW	6	121645253	missense	probably benign
R5590:A2m	UTSW	6	121676932	missense	probably damaging	1.00
R5835:A2m	UTSW	6	121639336	missense	probably damaging	1.00
R5910:A2m	UTSW	6	121668117	missense	probably damaging	1.00
R5915:A2m	UTSW	6	121667163	missense	probably damaging	1.00
R5949:A2m	UTSW	6	121678073	missense	probably damaging	1.00
R5994:A2m	UTSW	6	121670903	missense	probably benign	0.38
R5996:A2m	UTSW	6	121659394	missense	probably damaging	1.00
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6090:A2m	UTSW	6	121648013	missense	probably benign	0.45
R6241:A2m	UTSW	6	121646829	missense	probably benign	0.09
R6294:A2m	UTSW	6	121654481	missense	probably benign
R6492:A2m	UTSW	6	121654505	missense	probably benign	0.35
R6554:A2m	UTSW	6	121641287	missense	probably damaging	1.00
R6597:A2m	UTSW	6	121648121	missense	probably damaging	1.00
R6742:A2m	UTSW	6	121678036	missense	probably benign	0.01
R6795:A2m	UTSW	6	121648322	splice site	probably null
R6843:A2m	UTSW	6	121638401	missense	probably benign	0.01
R7013:A2m	UTSW	6	121641386	missense	probably null	0.00
R7137:A2m	UTSW	6	121677985	missense	possibly damaging	0.85
R7167:A2m	UTSW	6	121647971	missense	probably benign
R7294:A2m	UTSW	6	121673582	nonsense	probably null
R7452:A2m	UTSW	6	121641332	missense	probably damaging	1.00
R7507:A2m	UTSW	6	121675218	missense	probably benign	0.01
R7602:A2m	UTSW	6	121642007	missense	probably damaging	1.00
R7602:A2m	UTSW	6	121670936	missense	possibly damaging	0.79
R7709:A2m	UTSW	6	121660104	missense	possibly damaging	0.81
R7766:A2m	UTSW	6	121638341	missense	probably benign	0.08
R7921:A2m	UTSW	6	121677995	missense	probably benign	0.00
R8007:A2m	UTSW	6	121670886	intron	probably benign
R8291:A2m	UTSW	6	121678058	missense	probably damaging	1.00
R8542:A2m	UTSW	6	121657410	missense	probably benign	0.03
R8856:A2m	UTSW	6	121641390	missense	probably benign	0.00
R9023:A2m	UTSW	6	121659958	missense	possibly damaging	0.90
R9154:A2m	UTSW	6	121668553	missense	probably damaging	1.00
R9156:A2m	UTSW	6	121670998	missense	probably damaging	0.98
R9255:A2m	UTSW	6	121649836	missense	probably damaging	1.00
R9269:A2m	UTSW	6	121660906	missense	probably benign	0.38
R9325:A2m	UTSW	6	121669619	missense	possibly damaging	0.81
R9393:A2m	UTSW	6	121639311	missense	possibly damaging	0.91
X0057:A2m	UTSW	6	121668176	missense	probably damaging	1.00
X0060:A2m	UTSW	6	121676080	missense	probably damaging	1.00
X0063:A2m	UTSW	6	121646876	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CGGAGCAGCTACTTTCACAAG -3'
(R):5'- AAATGGAAACTCCTTCTCCCTCG -3'

Sequencing Primer
(F):5'- GCTACTTTCACAAGAGCGAAG -3'
(R):5'- CCTCGGGAGAACACTATATTTCAAGG -3'

Posted On

2014-09-18