Incidental Mutation 'R2092:Zfp74'
ID 231834
Institutional Source Beutler Lab
Gene Symbol Zfp74
Ensembl Gene ENSMUSG00000059975
Gene Name zinc finger protein 74
Synonyms KRAB8, 2810054M15Rik, Zfp66
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R2092 (G1)
Quality Score 217
Status Not validated
Chromosome 7
Chromosomal Location 29930815-29954089 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) G to A at 29953924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108205] [ENSMUST00000108211]
AlphaFold Q80W31
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077142
SMART Domains Protein: ENSMUSP00000076389
Gene: ENSMUSG00000063623

DomainStartEndE-ValueType
low complexity region 51 58 N/A INTRINSIC
low complexity region 86 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108205
SMART Domains Protein: ENSMUSP00000103840
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108211
SMART Domains Protein: ENSMUSP00000103846
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208342
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Other mutations in Zfp74
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Zfp74 UTSW 7 29954041 start gained probably benign
R0387:Zfp74 UTSW 7 29934754 missense probably benign 0.05
R0948:Zfp74 UTSW 7 29935937 critical splice donor site probably null
R1757:Zfp74 UTSW 7 29935061 missense probably benign 0.01
R1813:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1893:Zfp74 UTSW 7 29936045 critical splice acceptor site probably null
R1896:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1958:Zfp74 UTSW 7 29935711 missense probably benign 0.08
R2111:Zfp74 UTSW 7 29935018 nonsense probably null
R4894:Zfp74 UTSW 7 29936045 critical splice acceptor site probably benign
R5121:Zfp74 UTSW 7 29932507 splice site probably null
R5123:Zfp74 UTSW 7 29934733 missense probably damaging 1.00
R5129:Zfp74 UTSW 7 29932455 missense probably benign 0.00
R5213:Zfp74 UTSW 7 29935243 missense probably damaging 1.00
R5460:Zfp74 UTSW 7 29935891 missense probably benign 0.04
R5519:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R5589:Zfp74 UTSW 7 29934565 missense probably damaging 1.00
R6287:Zfp74 UTSW 7 29935776 missense probably benign
R6330:Zfp74 UTSW 7 29937987 missense probably damaging 1.00
R6370:Zfp74 UTSW 7 29932410 missense probably damaging 0.96
R6407:Zfp74 UTSW 7 29935623 missense probably damaging 1.00
R6694:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R6791:Zfp74 UTSW 7 29934435 missense probably benign 0.02
R7144:Zfp74 UTSW 7 29935165 missense probably damaging 0.98
R7662:Zfp74 UTSW 7 29953853 critical splice donor site probably null
R7667:Zfp74 UTSW 7 29935183 missense probably damaging 1.00
R7898:Zfp74 UTSW 7 29935955 nonsense probably null
R7940:Zfp74 UTSW 7 29932442 missense probably benign 0.07
R8676:Zfp74 UTSW 7 29934654 missense probably damaging 1.00
R8864:Zfp74 UTSW 7 29934810 missense probably damaging 1.00
R8940:Zfp74 UTSW 7 29935347 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGTCACATCACGGCTGCTG -3'
(R):5'- AGAACGCAAGGGATCCTTTC -3'

Sequencing Primer
(F):5'- TCACGGCTGCTGCAAAC -3'
(R):5'- CGGATTCTTCTCAGTTGCAAG -3'
Posted On 2014-09-18