Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:Kif22'

231844

Institutional Source

Beutler Lab

Gene Symbol

Kif22

Ensembl Gene

ENSMUSG00000030677

Gene Name

kinesin family member 22

Synonyms

Kid, Kif22a

MMRRC Submission

040097-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127027729-127042471 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127033630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 195 (D195N)

Ref Sequence

ENSEMBL: ENSMUSP00000032915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000205806]

AlphaFold

Q3V300

Predicted Effect

probably damaging
Transcript: ENSMUST00000032915
AA Change: D195N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677
AA Change: D195N

Domain	Start	End	E-Value	Type
KISc	36	371	1.12e-140	SMART
low complexity region	399	428	N/A	INTRINSIC
coiled coil region	460	496	N/A	INTRINSIC
HhH1	597	616	2.16e0	SMART
HhH1	627	646	8.65e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205754

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205806
AA Change: D147N

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206412

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206873

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206924

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to implantation due to defective meiosis II and early embryo mitosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Kif22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Kif22	APN	7	127033473	missense	probably damaging	0.96
IGL01333:Kif22	APN	7	127034195	missense	probably damaging	1.00
R0207:Kif22	UTSW	7	127042400	start codon destroyed	probably null	0.73
R0723:Kif22	UTSW	7	127033906	missense	probably damaging	1.00
R1118:Kif22	UTSW	7	127032744	missense	probably benign
R1521:Kif22	UTSW	7	127027839	missense	probably damaging	0.99
R2036:Kif22	UTSW	7	127030954	missense	possibly damaging	0.94
R3790:Kif22	UTSW	7	127029496	missense	probably damaging	1.00
R4587:Kif22	UTSW	7	127032880	critical splice donor site	probably null
R4667:Kif22	UTSW	7	127033328	missense	probably damaging	1.00
R5082:Kif22	UTSW	7	127033377	missense	possibly damaging	0.71
R5853:Kif22	UTSW	7	127033367	missense	possibly damaging	0.92
R6045:Kif22	UTSW	7	127031078	missense	probably benign	0.00
R6175:Kif22	UTSW	7	127031056	missense	possibly damaging	0.53
R6195:Kif22	UTSW	7	127028959	missense	probably damaging	0.99
R6407:Kif22	UTSW	7	127033203	missense	probably damaging	1.00
R6416:Kif22	UTSW	7	127028932	missense	possibly damaging	0.95
R6561:Kif22	UTSW	7	127031053	missense	probably benign	0.38
R7122:Kif22	UTSW	7	127032978	missense	probably benign	0.01
R7644:Kif22	UTSW	7	127032962	missense	probably damaging	1.00
R8143:Kif22	UTSW	7	127033225	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCTTACCTTGACCAAGAG -3'
(R):5'- TACCAGGGCCATCTAGAGAG -3'

Sequencing Primer
(F):5'- TTGACCAAGAGCACTGCGTG -3'
(R):5'- GAGGACATGAAGCTCTCCTCTAG -3'

Posted On

2014-09-18