Incidental Mutation 'R2092:Dmbt1'
ID 231845
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission 040097-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R2092 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 131032053-131121630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 131050018 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 330 (W330L)
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: W215L
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: W215L

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: W226L
Predicted Effect probably damaging
Transcript: ENSMUST00000213064
AA Change: W330L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 (GRCm38) C1321* probably null Het
Abca8b A G 11: 109,966,708 (GRCm38) F673L possibly damaging Het
Adam19 T G 11: 46,060,904 (GRCm38) probably null Het
AI987944 T C 7: 41,374,617 (GRCm38) T313A possibly damaging Het
Akap13 A T 7: 75,610,570 (GRCm38) I178F probably benign Het
Alb G GA 5: 90,463,983 (GRCm38) probably null Het
Bod1l A G 5: 41,831,517 (GRCm38) S416P probably damaging Het
Casr A T 16: 36,510,043 (GRCm38) Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 (GRCm38) N152S probably benign Het
Chrdl2 T A 7: 100,020,977 (GRCm38) C102* probably null Het
Col4a4 G A 1: 82,498,946 (GRCm38) S554L unknown Het
Col6a4 T C 9: 106,060,331 (GRCm38) K1392R probably damaging Het
Dab1 T G 4: 104,678,777 (GRCm38) Y128D probably damaging Het
Dars A T 1: 128,374,018 (GRCm38) M293K probably damaging Het
Dlec1 T C 9: 119,121,844 (GRCm38) F493L possibly damaging Het
Dnah11 A T 12: 118,012,716 (GRCm38) M831K possibly damaging Het
Dock7 T C 4: 99,009,308 (GRCm38) N715S possibly damaging Het
Edc4 T A 8: 105,887,528 (GRCm38) L12Q probably damaging Het
Edem2 T C 2: 155,709,049 (GRCm38) M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 (GRCm38) probably null Het
Fto C A 8: 91,409,687 (GRCm38) Y194* probably null Het
Gnptab T G 10: 88,440,305 (GRCm38) Y1151* probably null Het
Grm1 A G 10: 10,689,225 (GRCm38) L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 (GRCm38) K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 (GRCm38) D70G probably damaging Het
Irx4 C A 13: 73,265,486 (GRCm38) T25K probably damaging Het
Kif22 C T 7: 127,033,630 (GRCm38) D195N probably damaging Het
Lrp2 C T 2: 69,536,021 (GRCm38) D245N probably benign Het
Lyz1 C T 10: 117,288,599 (GRCm38) R144Q probably benign Het
Macf1 T A 4: 123,383,178 (GRCm38) T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 (GRCm38) V249I probably benign Het
Myh9 G A 15: 77,764,350 (GRCm38) Q80* probably null Het
Myo6 G T 9: 80,245,682 (GRCm38) R199L probably damaging Het
Naglu G A 11: 101,076,720 (GRCm38) V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 (GRCm38) F140S probably benign Het
Olfr1208 A G 2: 88,897,267 (GRCm38) F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 (GRCm38) Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 (GRCm38) probably null Het
Olfr598 G A 7: 103,329,109 (GRCm38) V208M probably damaging Het
Olfr67 A T 7: 103,788,072 (GRCm38) F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 (GRCm38) L82Q probably damaging Het
Otop1 A T 5: 38,299,766 (GRCm38) I290F probably damaging Het
P2rx2 C T 5: 110,341,141 (GRCm38) D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 (GRCm38) I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 (GRCm38) H423R probably benign Het
Ptk2 A T 15: 73,236,191 (GRCm38) Y56* probably null Het
Rapgef3 T C 15: 97,760,723 (GRCm38) D134G probably damaging Het
Scaf11 A C 15: 96,415,827 (GRCm38) S1358A probably damaging Het
Scn9a T C 2: 66,533,376 (GRCm38) M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 (GRCm38) E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 (GRCm38) T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 (GRCm38) I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 (GRCm38) D555E probably benign Het
Smc5 T C 19: 23,238,899 (GRCm38) I446V probably benign Het
St6gal2 T C 17: 55,510,266 (GRCm38) Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 (GRCm38) Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 (GRCm38) L187P probably damaging Het
Tg A G 15: 66,849,607 (GRCm38) I322V probably null Het
Thap12 T C 7: 98,716,449 (GRCm38) V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 (GRCm38) S22P probably damaging Het
Ttc3 C T 16: 94,442,832 (GRCm38) P1232S probably benign Het
Upk3a A G 15: 85,018,085 (GRCm38) T38A probably damaging Het
Utrn A T 10: 12,678,698 (GRCm38) M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 (GRCm38) D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 (GRCm38) T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 (GRCm38) S279L probably damaging Het
Zer1 G A 2: 30,108,274 (GRCm38) L342F probably damaging Het
Zfp641 G T 15: 98,293,712 (GRCm38) T31N probably benign Het
Zfp74 G A 7: 29,953,924 (GRCm38) probably benign Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131,079,540 (GRCm38) intron probably benign
IGL00161:Dmbt1 APN 7 131,109,628 (GRCm38) missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131,099,290 (GRCm38) missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131,082,500 (GRCm38) missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131,097,607 (GRCm38) missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131,058,158 (GRCm38) missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131,085,368 (GRCm38) splice site probably benign
IGL01317:Dmbt1 APN 7 131,041,191 (GRCm38) missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131,088,767 (GRCm38) missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131,103,679 (GRCm38) missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131,116,728 (GRCm38) missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131,081,185 (GRCm38) missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131,074,419 (GRCm38) intron probably benign
IGL02160:Dmbt1 APN 7 131,082,688 (GRCm38) missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131,093,256 (GRCm38) splice site probably benign
IGL02197:Dmbt1 APN 7 131,085,422 (GRCm38) splice site probably benign
IGL02332:Dmbt1 APN 7 131,066,613 (GRCm38) intron probably benign
IGL02427:Dmbt1 APN 7 131,088,085 (GRCm38) splice site probably null
IGL02726:Dmbt1 APN 7 131,074,410 (GRCm38) intron probably benign
IGL02967:Dmbt1 APN 7 131,071,189 (GRCm38) missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131,082,679 (GRCm38) missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131,111,049 (GRCm38) missense probably damaging 0.99
cavity UTSW 7 131,112,236 (GRCm38) missense unknown
lacunar UTSW 7 131,097,631 (GRCm38) missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 131,037,890 (GRCm38) missense probably benign 0.16
BB015:Dmbt1 UTSW 7 131,037,890 (GRCm38) missense probably benign 0.16
H8562:Dmbt1 UTSW 7 131,112,076 (GRCm38) nonsense probably null
K3955:Dmbt1 UTSW 7 131,119,564 (GRCm38) missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131,119,496 (GRCm38) missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131,119,496 (GRCm38) missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131,106,393 (GRCm38) missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131,096,049 (GRCm38) splice site probably benign
R0427:Dmbt1 UTSW 7 131,040,902 (GRCm38) nonsense probably null
R0478:Dmbt1 UTSW 7 131,041,187 (GRCm38) missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131,097,673 (GRCm38) splice site probably null
R0538:Dmbt1 UTSW 7 131,049,901 (GRCm38) splice site probably benign
R0626:Dmbt1 UTSW 7 131,102,081 (GRCm38) missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131,097,653 (GRCm38) missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131,093,117 (GRCm38) missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131,074,524 (GRCm38) critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131,050,214 (GRCm38) missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131,044,487 (GRCm38) splice site probably benign
R1463:Dmbt1 UTSW 7 131,109,637 (GRCm38) critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131,074,331 (GRCm38) intron probably benign
R1990:Dmbt1 UTSW 7 131,058,288 (GRCm38) missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131,110,989 (GRCm38) missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131,110,989 (GRCm38) missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131,106,359 (GRCm38) missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131,106,170 (GRCm38) missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131,106,170 (GRCm38) missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131,106,170 (GRCm38) missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131,106,170 (GRCm38) missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131,099,133 (GRCm38) missense possibly damaging 0.66
R2102:Dmbt1 UTSW 7 131,102,032 (GRCm38) missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131,097,575 (GRCm38) missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131,046,562 (GRCm38) missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131,090,494 (GRCm38) missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131,106,468 (GRCm38) missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131,094,734 (GRCm38) nonsense probably null
R3014:Dmbt1 UTSW 7 131,032,097 (GRCm38) intron probably benign
R3155:Dmbt1 UTSW 7 131,050,157 (GRCm38) nonsense probably null
R3176:Dmbt1 UTSW 7 131,088,071 (GRCm38) missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131,088,071 (GRCm38) missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131,106,249 (GRCm38) missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131,112,090 (GRCm38) missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131,074,202 (GRCm38) intron probably benign
R4396:Dmbt1 UTSW 7 131,116,632 (GRCm38) missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131,040,934 (GRCm38) missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131,050,012 (GRCm38) missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131,094,742 (GRCm38) missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131,097,670 (GRCm38) critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131,094,735 (GRCm38) missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131,082,619 (GRCm38) missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131,041,021 (GRCm38) missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131,119,511 (GRCm38) missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131,040,993 (GRCm38) missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131,063,403 (GRCm38) intron probably benign
R5526:Dmbt1 UTSW 7 131,041,190 (GRCm38) missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131,099,300 (GRCm38) nonsense probably null
R5566:Dmbt1 UTSW 7 131,106,273 (GRCm38) missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131,054,067 (GRCm38) missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131,109,641 (GRCm38) splice site probably null
R6188:Dmbt1 UTSW 7 131,097,631 (GRCm38) missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131,066,733 (GRCm38) missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131,066,733 (GRCm38) missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131,058,254 (GRCm38) missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131,103,578 (GRCm38) missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131,116,641 (GRCm38) missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131,046,510 (GRCm38) splice site probably null
R6719:Dmbt1 UTSW 7 131,119,603 (GRCm38) missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131,046,561 (GRCm38) missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131,066,734 (GRCm38) nonsense probably null
R7191:Dmbt1 UTSW 7 131,044,520 (GRCm38) missense unknown
R7269:Dmbt1 UTSW 7 131,066,621 (GRCm38) missense unknown
R7288:Dmbt1 UTSW 7 131,083,789 (GRCm38) nonsense probably null
R7296:Dmbt1 UTSW 7 131,112,132 (GRCm38) missense unknown
R7349:Dmbt1 UTSW 7 131,041,124 (GRCm38) missense unknown
R7386:Dmbt1 UTSW 7 131,112,236 (GRCm38) missense unknown
R7428:Dmbt1 UTSW 7 131,108,463 (GRCm38) missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131,079,511 (GRCm38) critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131,066,462 (GRCm38) missense unknown
R7513:Dmbt1 UTSW 7 131,090,512 (GRCm38) missense unknown
R7553:Dmbt1 UTSW 7 131,104,867 (GRCm38) missense unknown
R7567:Dmbt1 UTSW 7 131,061,363 (GRCm38) splice site probably null
R7584:Dmbt1 UTSW 7 131,088,751 (GRCm38) nonsense probably null
R7736:Dmbt1 UTSW 7 131,116,896 (GRCm38) missense unknown
R7758:Dmbt1 UTSW 7 131,121,197 (GRCm38) missense unknown
R7928:Dmbt1 UTSW 7 131,037,890 (GRCm38) missense probably benign 0.16
R8080:Dmbt1 UTSW 7 131,088,770 (GRCm38) missense unknown
R8098:Dmbt1 UTSW 7 131,108,459 (GRCm38) nonsense probably null
R8125:Dmbt1 UTSW 7 131,099,223 (GRCm38) missense unknown
R8177:Dmbt1 UTSW 7 131,106,432 (GRCm38) missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 131,085,417 (GRCm38) critical splice donor site probably null
R8366:Dmbt1 UTSW 7 131,066,600 (GRCm38) missense unknown
R8378:Dmbt1 UTSW 7 131,106,465 (GRCm38) missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 131,082,587 (GRCm38) missense unknown
R8400:Dmbt1 UTSW 7 131,082,587 (GRCm38) missense unknown
R8445:Dmbt1 UTSW 7 131,090,380 (GRCm38) missense unknown
R8450:Dmbt1 UTSW 7 131,085,417 (GRCm38) critical splice donor site probably null
R8511:Dmbt1 UTSW 7 131,102,012 (GRCm38) missense unknown
R8688:Dmbt1 UTSW 7 131,058,254 (GRCm38) missense unknown
R8850:Dmbt1 UTSW 7 131,090,404 (GRCm38) missense unknown
R8852:Dmbt1 UTSW 7 131,041,123 (GRCm38) missense unknown
R8871:Dmbt1 UTSW 7 131,116,868 (GRCm38) missense unknown
R8943:Dmbt1 UTSW 7 131,119,643 (GRCm38) missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 131,037,881 (GRCm38) missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 131,112,069 (GRCm38) missense unknown
R9020:Dmbt1 UTSW 7 131,111,058 (GRCm38) missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 131,116,689 (GRCm38) missense unknown
R9230:Dmbt1 UTSW 7 131,037,912 (GRCm38) missense probably benign 0.01
R9304:Dmbt1 UTSW 7 131,099,125 (GRCm38) missense unknown
R9377:Dmbt1 UTSW 7 131,093,102 (GRCm38) missense unknown
R9428:Dmbt1 UTSW 7 131,066,478 (GRCm38) missense unknown
R9474:Dmbt1 UTSW 7 131,074,257 (GRCm38) missense unknown
R9573:Dmbt1 UTSW 7 131,056,180 (GRCm38) critical splice donor site probably null
R9675:Dmbt1 UTSW 7 131,110,923 (GRCm38) missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 131,058,285 (GRCm38) missense unknown
R9781:Dmbt1 UTSW 7 131,037,869 (GRCm38) missense probably benign 0.00
X0024:Dmbt1 UTSW 7 131,112,248 (GRCm38) nonsense probably null
X0062:Dmbt1 UTSW 7 131,094,851 (GRCm38) missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 131,088,812 (GRCm38) missense unknown
Z1177:Dmbt1 UTSW 7 131,082,485 (GRCm38) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGTGTCCCACAAAGTGTAC -3'
(R):5'- CCTGAACAGATGACTCCAGC -3'

Sequencing Primer
(F):5'- GTGTCCCACAAAGTGTACAAGGTC -3'
(R):5'- TGTCCACAGTTATGAGAGAGCC -3'
Posted On 2014-09-18