Incidental Mutation 'R2092:Slc25a15'
ID 231847
Institutional Source Beutler Lab
Gene Symbol Slc25a15
Ensembl Gene ENSMUSG00000031482
Gene Name solute carrier family 25 (mitochondrial carrier ornithine transporter), member 15
Synonyms D630044L02Rik, Ornt1
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2092 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 22375551-22398597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22380934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 176 (T176A)
Ref Sequence ENSEMBL: ENSMUSP00000033871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033871]
AlphaFold Q9WVD5
Predicted Effect probably damaging
Transcript: ENSMUST00000033871
AA Change: T176A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033871
Gene: ENSMUSG00000031482
AA Change: T176A

DomainStartEndE-ValueType
Pfam:Mito_carr 5 96 8.5e-19 PFAM
Pfam:Mito_carr 102 202 7.1e-22 PFAM
Pfam:Mito_carr 205 298 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210020
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the mitochondrial carrier family. The encoded protein transports ornithine across the inner mitochondrial membrane from the cytosol to the mitochondrial matrix. The protein is an essential component of the urea cycle, and functions in ammonium detoxification and biosynthesis of the amino acid arginine. Mutations in this gene result in hyperornithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome. There is a pseudogene of this locus on the Y chromosome.[provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Slc25a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Slc25a15 APN 8 22390036 missense possibly damaging 0.54
IGL03046:Slc25a15 APN 8 22395710 splice site probably benign
R1921:Slc25a15 UTSW 8 22395761 missense probably benign
R4762:Slc25a15 UTSW 8 22383232 missense probably damaging 0.97
R5451:Slc25a15 UTSW 8 22389967 missense probably benign 0.04
R9012:Slc25a15 UTSW 8 22377862 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AAGGAGTGAGCACCACCTAC -3'
(R):5'- TTGGCTGCATGAGTCATCC -3'

Sequencing Primer
(F):5'- GTGAGCACCACCTACGGAAG -3'
(R):5'- GCTGCATGAGTCATCCTGGATAC -3'
Posted On 2014-09-18