Incidental Mutation 'R2092:Olfr935'
ID231850
Institutional Source Beutler Lab
Gene Symbol Olfr935
Ensembl Gene ENSMUSG00000059595
Gene Nameolfactory receptor 935
SynonymsGA_x6K02T2PVTD-32691280-32690354, MOR171-11
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2092 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38993971-38999683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38995189 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 82 (L82Q)
Ref Sequence ENSEMBL: ENSMUSP00000149193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080748] [ENSMUST00000214157]
Predicted Effect probably damaging
Transcript: ENSMUST00000080748
AA Change: L82Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079572
Gene: ENSMUSG00000059595
AA Change: L82Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4e-53 PFAM
Pfam:7tm_1 41 290 1.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214157
AA Change: L82Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Olfr935
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr935 APN 9 38995100 missense probably benign 0.08
IGL01671:Olfr935 APN 9 38994853 missense probably benign 0.05
IGL02331:Olfr935 APN 9 38995106 missense probably damaging 0.99
IGL03069:Olfr935 APN 9 38995432 start codon destroyed probably null 0.98
IGL03143:Olfr935 APN 9 38995436 utr 5 prime probably benign
R0149:Olfr935 UTSW 9 38994584 missense probably benign 0.05
R0400:Olfr935 UTSW 9 38995198 missense probably damaging 1.00
R1818:Olfr935 UTSW 9 38994606 missense possibly damaging 0.61
R2151:Olfr935 UTSW 9 38994716 missense probably damaging 1.00
R2166:Olfr935 UTSW 9 38995217 nonsense probably null
R2347:Olfr935 UTSW 9 38994509 makesense probably null
R4404:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R4406:Olfr935 UTSW 9 38994569 missense possibly damaging 0.77
R5152:Olfr935 UTSW 9 38995177 missense possibly damaging 0.88
R5467:Olfr935 UTSW 9 38994904 missense probably benign 0.14
R5509:Olfr935 UTSW 9 38994628 missense probably benign 0.03
R5954:Olfr935 UTSW 9 38995415 missense probably damaging 1.00
R6647:Olfr935 UTSW 9 38994914 missense possibly damaging 0.55
R6680:Olfr935 UTSW 9 38994658 missense probably damaging 1.00
R6928:Olfr935 UTSW 9 38994632 missense probably benign 0.03
R7242:Olfr935 UTSW 9 38995141 missense probably benign 0.31
R7271:Olfr935 UTSW 9 38994657 nonsense probably null
R7309:Olfr935 UTSW 9 38995280 missense probably damaging 1.00
R7775:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7778:Olfr935 UTSW 9 38994907 missense probably damaging 1.00
R7866:Olfr935 UTSW 9 38994731 missense not run
R7949:Olfr935 UTSW 9 38994731 missense not run
Predicted Primers PCR Primer
(F):5'- GCTGATGCACAAACTATGCC -3'
(R):5'- AGAACTACAGCTGCCACTCTTC -3'

Sequencing Primer
(F):5'- CTGATGCACAAACTATGCCTATAATG -3'
(R):5'- CCTCCTCTTTCTTGGAATCTACCTG -3'
Posted On2014-09-18