Incidental Mutation 'R2092:Myo6'
ID 231851
Institutional Source Beutler Lab
Gene Symbol Myo6
Ensembl Gene ENSMUSG00000033577
Gene Name myosin VI
Synonyms Tlc
MMRRC Submission 040097-MU
Accession Numbers

MGI:104785

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2092 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 80165031-80311729 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80245682 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 199 (R199L)
Ref Sequence ENSEMBL: ENSMUSP00000108891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035889] [ENSMUST00000076140] [ENSMUST00000113266] [ENSMUST00000113268] [ENSMUST00000127779] [ENSMUST00000184480]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035889
AA Change: R199L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577
AA Change: R199L

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000076140
AA Change: R199L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577
AA Change: R199L

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000113266
AA Change: R199L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577
AA Change: R199L

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect unknown
Transcript: ENSMUST00000113268
AA Change: R199L
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577
AA Change: R199L

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127779
AA Change: R199L
SMART Domains Protein: ENSMUSP00000139228
Gene: ENSMUSG00000033577
AA Change: R199L

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1136 1e-26 BLAST
PDB:3H8D|D 1157 1285 9e-75 PDB
Predicted Effect unknown
Transcript: ENSMUST00000184480
AA Change: R199L
SMART Domains Protein: ENSMUSP00000139019
Gene: ENSMUSG00000033577
AA Change: R199L

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1145 1e-25 BLAST
PDB:3H8D|D 1166 1294 8e-75 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a reverse-direction motor protein that moves toward the minus end of actin filaments and plays a role in intracellular vesicle and organelle transport. The protein consists of a motor domain containing an ATP- and an actin-binding site and a globular tail which interacts with other proteins. This protein maintains the structural integrity of inner ear hair cells and mutations in this gene cause non-syndromic autosomal dominant and recessive hearing loss. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutant mice exhibit deafness and related behavioral characteristics such as circling, head tossing and hyperactivity. Progressive degeneration of the cochlear hair cells and the organ of Corti is observed with one mutation. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(6) Spontaneous(3) Chemically induced(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Myo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Myo6 APN 9 80292472 missense probably damaging 0.98
IGL00584:Myo6 APN 9 80242273 splice site probably benign
IGL00596:Myo6 APN 9 80281743 missense possibly damaging 0.91
IGL00778:Myo6 APN 9 80283586 critical splice donor site probably null
IGL01667:Myo6 APN 9 80289893 missense unknown
IGL01939:Myo6 APN 9 80260818 missense probably damaging 1.00
IGL02123:Myo6 APN 9 80264272 splice site probably benign
IGL02271:Myo6 APN 9 80260831 missense probably benign 0.01
IGL02512:Myo6 APN 9 80292519 critical splice donor site probably null
IGL02716:Myo6 APN 9 80269694 missense probably damaging 1.00
IGL02888:Myo6 APN 9 80269731 splice site probably benign
IGL02890:Myo6 APN 9 80266174 missense probably damaging 1.00
IGL02951:Myo6 APN 9 80264234 missense possibly damaging 0.66
IGL02990:Myo6 APN 9 80276403 critical splice donor site probably null
IGL03060:Myo6 APN 9 80260877 missense probably benign 0.00
IGL03145:Myo6 APN 9 80300665 nonsense probably null
IGL03306:Myo6 APN 9 80246555 missense probably damaging 1.00
mayday_circler UTSW 9 80246451 nonsense probably null
torticollis UTSW 9 80288217 critical splice donor site probably null
toss UTSW 9 80300667 critical splice donor site probably null
truths UTSW 9 80270039 nonsense probably null
unbiased UTSW 9 80273975 splice site probably benign
IGL03134:Myo6 UTSW 9 80292467 missense probably damaging 0.96
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0023:Myo6 UTSW 9 80283534 missense possibly damaging 0.62
R0124:Myo6 UTSW 9 80307774 missense probably damaging 1.00
R0133:Myo6 UTSW 9 80273975 splice site probably benign
R0207:Myo6 UTSW 9 80288056 missense probably damaging 1.00
R0295:Myo6 UTSW 9 80283579 missense probably damaging 0.98
R0389:Myo6 UTSW 9 80292466 missense probably damaging 0.98
R0432:Myo6 UTSW 9 80273974 splice site probably benign
R0526:Myo6 UTSW 9 80283541 missense possibly damaging 0.61
R0791:Myo6 UTSW 9 80262374 splice site probably benign
R0885:Myo6 UTSW 9 80242221 missense probably damaging 1.00
R1082:Myo6 UTSW 9 80288021 missense probably damaging 1.00
R1113:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1184:Myo6 UTSW 9 80286382 nonsense probably null
R1308:Myo6 UTSW 9 80245714 missense probably damaging 1.00
R1498:Myo6 UTSW 9 80307679 missense probably damaging 1.00
R1609:Myo6 UTSW 9 80288217 critical splice donor site probably null
R1615:Myo6 UTSW 9 80307725 missense probably damaging 1.00
R1771:Myo6 UTSW 9 80285800 missense probably damaging 1.00
R1772:Myo6 UTSW 9 80270049 missense possibly damaging 0.95
R1789:Myo6 UTSW 9 80300572 missense probably damaging 1.00
R1962:Myo6 UTSW 9 80260835 missense probably damaging 1.00
R1978:Myo6 UTSW 9 80228925 missense probably damaging 0.99
R2011:Myo6 UTSW 9 80307722 missense probably damaging 0.99
R2098:Myo6 UTSW 9 80281526 missense probably damaging 1.00
R2206:Myo6 UTSW 9 80258455 missense probably benign 0.01
R2286:Myo6 UTSW 9 80266212 missense possibly damaging 0.82
R2429:Myo6 UTSW 9 80303301 critical splice donor site probably null
R2696:Myo6 UTSW 9 80260894 missense probably benign 0.00
R2897:Myo6 UTSW 9 80269611 splice site probably null
R2898:Myo6 UTSW 9 80269611 splice site probably null
R3881:Myo6 UTSW 9 80264256 missense probably damaging 1.00
R4424:Myo6 UTSW 9 80288038 missense probably benign 0.26
R4718:Myo6 UTSW 9 80246517 missense probably benign 0.01
R4893:Myo6 UTSW 9 80228877 missense probably damaging 1.00
R4936:Myo6 UTSW 9 80307681 missense probably damaging 1.00
R4992:Myo6 UTSW 9 80283510 missense possibly damaging 0.95
R5073:Myo6 UTSW 9 80288008 missense probably benign 0.00
R5101:Myo6 UTSW 9 80270039 nonsense probably null
R5137:Myo6 UTSW 9 80242249 missense probably damaging 1.00
R5200:Myo6 UTSW 9 80276374 nonsense probably null
R5510:Myo6 UTSW 9 80245660 missense probably damaging 1.00
R5579:Myo6 UTSW 9 80217720 missense probably damaging 0.99
R5693:Myo6 UTSW 9 80266180 missense probably damaging 1.00
R5701:Myo6 UTSW 9 80258527 missense probably damaging 1.00
R6693:Myo6 UTSW 9 80245731 missense probably damaging 1.00
R7151:Myo6 UTSW 9 80245136 missense unknown
R7399:Myo6 UTSW 9 80262291 missense unknown
R7492:Myo6 UTSW 9 80288046 nonsense probably null
R7651:Myo6 UTSW 9 80264266 critical splice donor site probably null
R7698:Myo6 UTSW 9 80217656 missense unknown
R7743:Myo6 UTSW 9 80276329 missense unknown
R7888:Myo6 UTSW 9 80296665 missense probably damaging 0.99
R8161:Myo6 UTSW 9 80217709 missense unknown
R8245:Myo6 UTSW 9 80254947 missense unknown
R8375:Myo6 UTSW 9 80254924 missense unknown
R8387:Myo6 UTSW 9 80276350 missense unknown
R8467:Myo6 UTSW 9 80228886 missense probably damaging 1.00
R8669:Myo6 UTSW 9 80266249 missense unknown
R8770:Myo6 UTSW 9 80264199 missense unknown
R8807:Myo6 UTSW 9 80300667 critical splice donor site probably null
R9006:Myo6 UTSW 9 80228858 missense unknown
R9018:Myo6 UTSW 9 80251804 missense unknown
R9038:Myo6 UTSW 9 80255003 missense unknown
R9124:Myo6 UTSW 9 80288071 missense unknown
R9190:Myo6 UTSW 9 80288102 missense unknown
R9194:Myo6 UTSW 9 80246554 missense unknown
R9281:Myo6 UTSW 9 80254882 nonsense probably null
Z1191:Myo6 UTSW 9 80242227 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTCATGGTGATCTATGAACC -3'
(R):5'- CTGAATAGAAGTTCTGGATACTCACTG -3'

Sequencing Primer
(F):5'- AGGCTTGTCCCCTAGATGAC -3'
(R):5'- CTGGATACTCACTGTAAATACATAC -3'
Posted On 2014-09-18