Incidental Mutation 'R2092:Col6a4'
ID231853
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2092 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106060331 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1392 (K1392R)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably damaging
Transcript: ENSMUST00000121963
AA Change: K1392R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: K1392R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R7964:Col6a4 UTSW 9 106080298 missense probably benign 0.14
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGAACCTGTGTCACATGTG -3'
(R):5'- TGAGTGACCAACTGAGGCAG -3'

Sequencing Primer
(F):5'- TGGGTCACACTACACACT -3'
(R):5'- TGGGTTCTAAAGATGGGTAGTAAAC -3'
Posted On2014-09-18