Mutagenetix > Incidental Mutation

Incidental Mutation 'R2092:Gnptab'

231857

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

040097-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to G at 88440305 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1151 (Y1151*)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

AlphaFold

Q69ZN6

Predicted Effect

probably null
Transcript: ENSMUST00000020251
AA Change: Y1151*

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: Y1151*

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149562

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155306

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Ttc3	C	T	16: 94,442,832	P1232S	probably benign	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
R8351:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R8487:Gnptab	UTSW	10	88432646	critical splice donor site	probably null
R9108:Gnptab	UTSW	10	88433538	missense
R9352:Gnptab	UTSW	10	88432488	missense	probably benign	0.05
R9489:Gnptab	UTSW	10	88433130	missense	probably damaging	1.00
R9598:Gnptab	UTSW	10	88412014	missense	probably damaging	0.97
R9760:Gnptab	UTSW	10	88431448	missense	probably damaging	1.00
R9771:Gnptab	UTSW	10	88432623	missense	probably damaging	1.00
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTCCTCCAGGGAACAATGTC -3'
(R):5'- ACATGGCAGATAACACATTAAAGGC -3'

Sequencing Primer
(F):5'- ACAATGTCAGCGCGTGTG -3'
(R):5'- TTAAAGGCCAGACAGAAACATGC -3'

Posted On

2014-09-18