Incidental Mutation 'R2092:Gnptab'
ID 231857
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene Name N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms EG432486
MMRRC Submission 040097-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R2092 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 88379132-88447329 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 88440305 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1151 (Y1151*)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
AlphaFold Q69ZN6
Predicted Effect probably null
Transcript: ENSMUST00000020251
AA Change: Y1151*
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: Y1151*

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149562
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155306
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157 unclassified probably benign
R7316:Gnptab UTSW 10 88400710 missense probably damaging 1.00
R7463:Gnptab UTSW 10 88431389 missense probably damaging 1.00
R7596:Gnptab UTSW 10 88443370 missense probably damaging 0.99
R7654:Gnptab UTSW 10 88445819 missense possibly damaging 0.63
R7722:Gnptab UTSW 10 88379528 missense probably damaging 0.99
R7770:Gnptab UTSW 10 88411920 missense probably benign 0.41
R7791:Gnptab UTSW 10 88440222 critical splice acceptor site probably null
R7838:Gnptab UTSW 10 88440392 critical splice donor site probably null
R8002:Gnptab UTSW 10 88440268 missense probably benign 0.14
R8168:Gnptab UTSW 10 88419133 missense probably benign 0.41
R8219:Gnptab UTSW 10 88433792 missense probably benign
R8221:Gnptab UTSW 10 88440392 critical splice donor site probably null
R8313:Gnptab UTSW 10 88439209 missense probably damaging 1.00
R8351:Gnptab UTSW 10 88414486 missense probably benign 0.01
R8487:Gnptab UTSW 10 88432646 critical splice donor site probably null
R9108:Gnptab UTSW 10 88433538 missense
R9352:Gnptab UTSW 10 88432488 missense probably benign 0.05
R9489:Gnptab UTSW 10 88433130 missense probably damaging 1.00
R9598:Gnptab UTSW 10 88412014 missense probably damaging 0.97
R9760:Gnptab UTSW 10 88431448 missense probably damaging 1.00
R9771:Gnptab UTSW 10 88432623 missense probably damaging 1.00
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Z1176:Gnptab UTSW 10 88431368 missense probably damaging 1.00
Z1177:Gnptab UTSW 10 88440270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCTCCAGGGAACAATGTC -3'
(R):5'- ACATGGCAGATAACACATTAAAGGC -3'

Sequencing Primer
(F):5'- ACAATGTCAGCGCGTGTG -3'
(R):5'- TTAAAGGCCAGACAGAAACATGC -3'
Posted On 2014-09-18