Incidental Mutation 'R2092:Naglu'
ID231859
Institutional Source Beutler Lab
Gene Symbol Naglu
Ensembl Gene ENSMUSG00000001751
Gene Namealpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Synonyms
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2092 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101070012-101077672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101076720 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 499 (V499I)
Ref Sequence ENSEMBL: ENSMUSP00000001802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001802] [ENSMUST00000019445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001802
AA Change: V499I

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001802
Gene: ENSMUSG00000001751
AA Change: V499I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:NAGLU_N 28 114 4.8e-24 PFAM
Pfam:NAGLU 128 463 8.2e-150 PFAM
Pfam:NAGLU_C 471 731 4.5e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019445
SMART Domains Protein: ENSMUSP00000019445
Gene: ENSMUSG00000019301

DomainStartEndE-ValueType
Pfam:KR 4 174 3.5e-9 PFAM
Pfam:adh_short 4 200 1.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140735
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that degrades heparan sulfate by hydrolysis of terminal N-acetyl-D-glucosamine residues in N-acetyl-alpha-D-glucosaminides. Defects in this gene are the cause of mucopolysaccharidosis type IIIB (MPS-IIIB), also known as Sanfilippo syndrome B. This disease is characterized by the lysosomal accumulation and urinary excretion of heparan sulfate. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced open field activity, massive accumulation of heparan sulfate in kidney and liver, elevated gangliosides in brain, and presence of vacuoles in macrophages, epithelial cells, and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Nfkbie T C 17: 45,558,539 F140S probably benign Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Naglu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00845:Naglu APN 11 101076952 missense possibly damaging 0.84
IGL01025:Naglu APN 11 101073947 missense probably benign 0.01
IGL01775:Naglu APN 11 101074095 missense probably damaging 1.00
tulane UTSW 11 101070332 missense probably benign 0.01
R0044:Naglu UTSW 11 101071217 missense probably damaging 0.99
R0281:Naglu UTSW 11 101074027 missense probably damaging 0.99
R0395:Naglu UTSW 11 101074107 unclassified probably benign
R1624:Naglu UTSW 11 101076525 missense probably damaging 1.00
R1739:Naglu UTSW 11 101076403 missense possibly damaging 0.88
R4118:Naglu UTSW 11 101074082 missense probably benign 0.39
R4582:Naglu UTSW 11 101071929 missense probably damaging 0.97
R4792:Naglu UTSW 11 101071106 missense probably damaging 1.00
R4834:Naglu UTSW 11 101076988 missense probably benign
R5232:Naglu UTSW 11 101070150 missense probably benign 0.02
R5387:Naglu UTSW 11 101076724 missense probably damaging 1.00
R6463:Naglu UTSW 11 101077351 unclassified probably null
R6483:Naglu UTSW 11 101071181 missense probably damaging 1.00
R7141:Naglu UTSW 11 101072230 missense probably benign 0.10
R7187:Naglu UTSW 11 101070332 missense probably benign 0.01
R7232:Naglu UTSW 11 101076426 missense probably damaging 1.00
R7478:Naglu UTSW 11 101071899 missense probably damaging 1.00
R7828:Naglu UTSW 11 101076610 missense probably damaging 0.99
R7829:Naglu UTSW 11 101076610 missense probably damaging 0.99
X0023:Naglu UTSW 11 101072014 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGTGTATGCTCCACAACTTTG -3'
(R):5'- ACATCCAGCAGGTCATAGCG -3'

Sequencing Primer
(F):5'- CAACCATGGCCTGTTTGGAG -3'
(R):5'- CCAGCAGGTCATAGCGGAAGG -3'
Posted On2014-09-18