Mutagenetix > Incidental Mutations

Incidental Mutation 'R2092:Ttc3'

231878

Institutional Source

Beutler Lab

Gene Symbol

Ttc3

Ensembl Gene

ENSMUSG00000040785

Gene Name

tetratricopeptide repeat domain 3

Synonyms

2610202A04Rik, D16Ium21, D16Ium21e, TPRD

MMRRC Submission

040097-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.654) question?

Stock #

R2092 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94370618-94469343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 94442832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1232 (P1232S)

Ref Sequence

ENSEMBL: ENSMUSP00000156151 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000122895] [ENSMUST00000143145] [ENSMUST00000147352] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000155692] [ENSMUST00000231569] [ENSMUST00000231915] [ENSMUST00000232395] [ENSMUST00000232660]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000117648
AA Change: P1232S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785
AA Change: P1232S

Domain	Start	End	E-Value	Type
TPR	231	264	3.61e-2	SMART
TPR	265	298	3.32e-1	SMART
Blast:TPR	300	332	2e-12	BLAST
low complexity region	444	459	N/A	INTRINSIC
TPR	576	609	2.55e-2	SMART
low complexity region	720	732	N/A	INTRINSIC
coiled coil region	765	796	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC
low complexity region	1036	1050	N/A	INTRINSIC
low complexity region	1170	1190	N/A	INTRINSIC
low complexity region	1248	1260	N/A	INTRINSIC
low complexity region	1278	1291	N/A	INTRINSIC
coiled coil region	1472	1570	N/A	INTRINSIC
low complexity region	1876	1887	N/A	INTRINSIC
RING	1931	1970	7e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122895

SMART Domains

Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
TPR	213	246	3.61e-2	SMART
TPR	247	280	3.32e-1	SMART
Blast:TPR	282	314	3e-12	BLAST
low complexity region	426	441	N/A	INTRINSIC
TPR	558	591	2.55e-2	SMART
low complexity region	702	714	N/A	INTRINSIC
coiled coil region	747	778	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139607

Predicted Effect

probably benign
Transcript: ENSMUST00000143145

Predicted Effect

probably benign
Transcript: ENSMUST00000147352

SMART Domains

Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
TPR	213	246	3.61e-2	SMART
TPR	247	280	3.32e-1	SMART
Blast:TPR	282	314	3e-12	BLAST
low complexity region	426	441	N/A	INTRINSIC
TPR	558	591	2.55e-2	SMART
low complexity region	702	714	N/A	INTRINSIC
coiled coil region	747	778	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151770

SMART Domains

Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
TPR	231	264	3.61e-2	SMART
TPR	265	298	3.32e-1	SMART
Blast:TPR	300	332	3e-12	BLAST
low complexity region	444	459	N/A	INTRINSIC
TPR	576	609	2.55e-2	SMART
low complexity region	720	732	N/A	INTRINSIC
coiled coil region	765	796	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC
low complexity region	1036	1050	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152117

SMART Domains

Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
low complexity region	43	58	N/A	INTRINSIC
SCOP:d1ihga1	69	201	6e-8	SMART
Blast:TPR	175	208	1e-14	BLAST
low complexity region	319	331	N/A	INTRINSIC
coiled coil region	364	395	N/A	INTRINSIC
low complexity region	617	631	N/A	INTRINSIC
low complexity region	635	649	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155692

SMART Domains

Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
TPR	250	283	3.61e-2	SMART
TPR	284	317	3.32e-1	SMART
Blast:TPR	319	351	3e-12	BLAST
low complexity region	463	478	N/A	INTRINSIC
TPR	595	628	2.55e-2	SMART
low complexity region	739	751	N/A	INTRINSIC
coiled coil region	784	815	N/A	INTRINSIC
low complexity region	1037	1051	N/A	INTRINSIC
low complexity region	1055	1069	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231569
AA Change: P877S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000231915

Predicted Effect

probably benign
Transcript: ENSMUST00000232368

Predicted Effect

probably benign
Transcript: ENSMUST00000232395
AA Change: P1232S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000232660
AA Change: P1232S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,674,937	C1321*	probably null	Het
Abca8b	A	G	11: 109,966,708	F673L	possibly damaging	Het
Adam19	T	G	11: 46,060,904		probably null	Het
AI987944	T	C	7: 41,374,617	T313A	possibly damaging	Het
Akap13	A	T	7: 75,610,570	I178F	probably benign	Het
Alb	G	GA	5: 90,463,983		probably null	Het
Bod1l	A	G	5: 41,831,517	S416P	probably damaging	Het
Casr	A	T	16: 36,510,043	Y310N	possibly damaging	Het
Cela3a	T	C	4: 137,404,426	N152S	probably benign	Het
Chrdl2	T	A	7: 100,020,977	C102*	probably null	Het
Col4a4	G	A	1: 82,498,946	S554L	unknown	Het
Col6a4	T	C	9: 106,060,331	K1392R	probably damaging	Het
Dab1	T	G	4: 104,678,777	Y128D	probably damaging	Het
Dars	A	T	1: 128,374,018	M293K	probably damaging	Het
Dlec1	T	C	9: 119,121,844	F493L	possibly damaging	Het
Dmbt1	G	T	7: 131,050,018	W330L	probably damaging	Het
Dnah11	A	T	12: 118,012,716	M831K	possibly damaging	Het
Dock7	T	C	4: 99,009,308	N715S	possibly damaging	Het
Edc4	T	A	8: 105,887,528	L12Q	probably damaging	Het
Edem2	T	C	2: 155,709,049	M333V	probably benign	Het
Fpr-rs4	CAGGAA	CA	17: 18,022,334		probably null	Het
Fto	C	A	8: 91,409,687	Y194*	probably null	Het
Gnptab	T	G	10: 88,440,305	Y1151*	probably null	Het
Grm1	A	G	10: 10,689,225	L1113P	probably benign	Het
Hnrnpa0	T	C	13: 58,127,800	K172E	probably damaging	Het
Ifitm1	A	G	7: 140,969,514	D70G	probably damaging	Het
Irx4	C	A	13: 73,265,486	T25K	probably damaging	Het
Kif22	C	T	7: 127,033,630	D195N	probably damaging	Het
Lrp2	C	T	2: 69,536,021	D245N	probably benign	Het
Lyz1	C	T	10: 117,288,599	R144Q	probably benign	Het
Macf1	T	A	4: 123,383,178	T6055S	probably damaging	Het
Mrgpra2b	C	T	7: 47,464,160	V249I	probably benign	Het
Myh9	G	A	15: 77,764,350	Q80*	probably null	Het
Myo6	G	T	9: 80,245,682	R199L	probably damaging	Het
Naglu	G	A	11: 101,076,720	V499I	possibly damaging	Het
Nfkbie	T	C	17: 45,558,539	F140S	probably benign	Het
Olfr1208	A	G	2: 88,897,267	F110S	probably damaging	Het
Olfr1454	T	A	19: 13,063,802	Y130*	probably null	Het
Olfr510	CAAATA	CA	7: 108,667,662		probably null	Het
Olfr598	G	A	7: 103,329,109	V208M	probably damaging	Het
Olfr67	A	T	7: 103,788,072	F68L	possibly damaging	Het
Olfr935	A	T	9: 38,995,189	L82Q	probably damaging	Het
Otop1	A	T	5: 38,299,766	I290F	probably damaging	Het
P2rx2	C	T	5: 110,341,141	D203N	probably damaging	Het
Pcdhb10	T	A	18: 37,414,187	I772N	probably benign	Het
Pnliprp1	A	G	19: 58,741,184	H423R	probably benign	Het
Ptk2	A	T	15: 73,236,191	Y56*	probably null	Het
Rapgef3	T	C	15: 97,760,723	D134G	probably damaging	Het
Scaf11	A	C	15: 96,415,827	S1358A	probably damaging	Het
Scn9a	T	C	2: 66,533,376	M844V	probably damaging	Het
Sh3tc1	T	C	5: 35,700,658	E1121G	probably damaging	Het
Slc25a15	T	C	8: 22,380,934	T176A	probably damaging	Het
Slc29a4	T	A	5: 142,718,855	I384N	probably damaging	Het
Slc40a1	A	T	1: 45,909,454	D555E	probably benign	Het
Smc5	T	C	19: 23,238,899	I446V	probably benign	Het
St6gal2	T	C	17: 55,510,266	Y477H	probably damaging	Het
Syngr1	A	T	15: 80,115,940	Q84L	possibly damaging	Het
Tedc1	T	C	12: 113,157,720	L187P	probably damaging	Het
Tg	A	G	15: 66,849,607	I322V	probably null	Het
Thap12	T	C	7: 98,716,449	V608A	possibly damaging	Het
Tmbim6	T	C	15: 99,402,068	S22P	probably damaging	Het
Upk3a	A	G	15: 85,018,085	T38A	probably damaging	Het
Utrn	A	T	10: 12,678,698	M1549K	probably benign	Het
Vmn1r176	C	T	7: 23,835,153	D192N	probably damaging	Het
Vmn1r198	A	G	13: 22,354,715	T35A	possibly damaging	Het
Xkr7	C	T	2: 153,054,063	S279L	probably damaging	Het
Zer1	G	A	2: 30,108,274	L342F	probably damaging	Het
Zfp641	G	T	15: 98,293,712	T31N	probably benign	Het
Zfp74	G	A	7: 29,953,924		probably benign	Het

Other mutations in Ttc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Ttc3	APN	16	94426761	splice site	probably null
IGL00979:Ttc3	APN	16	94456718	missense	probably damaging	1.00
IGL01520:Ttc3	APN	16	94390207	missense	probably benign	0.04
IGL01663:Ttc3	APN	16	94409731	critical splice donor site	probably null
IGL01720:Ttc3	APN	16	94385369	missense	probably damaging	0.99
IGL01736:Ttc3	APN	16	94442527	missense	probably damaging	0.99
IGL02045:Ttc3	APN	16	94409681	splice site	probably benign
IGL02203:Ttc3	APN	16	94418598	splice site	probably benign
IGL02327:Ttc3	APN	16	94448108	missense	probably damaging	1.00
IGL02794:Ttc3	APN	16	94467926	missense	probably damaging	1.00
IGL02898:Ttc3	APN	16	94419426	missense	probably damaging	1.00
PIT4378001:Ttc3	UTSW	16	94410906	missense	probably benign	0.01
R0064:Ttc3	UTSW	16	94422247	missense	possibly damaging	0.79
R0098:Ttc3	UTSW	16	94390265	missense	probably benign	0.02
R0112:Ttc3	UTSW	16	94385322	splice site	probably benign
R0135:Ttc3	UTSW	16	94462268	missense	possibly damaging	0.92
R0480:Ttc3	UTSW	16	94432004	nonsense	probably null
R0513:Ttc3	UTSW	16	94426212	missense	probably damaging	1.00
R0532:Ttc3	UTSW	16	94387330	splice site	probably benign
R0607:Ttc3	UTSW	16	94456785	nonsense	probably null
R0742:Ttc3	UTSW	16	94459880	missense	probably benign	0.23
R0905:Ttc3	UTSW	16	94456789	nonsense	probably null
R1118:Ttc3	UTSW	16	94416268	splice site	probably benign
R1355:Ttc3	UTSW	16	94418637	missense	possibly damaging	0.46
R1370:Ttc3	UTSW	16	94418637	missense	possibly damaging	0.46
R1486:Ttc3	UTSW	16	94448129	missense	probably damaging	1.00
R1598:Ttc3	UTSW	16	94422297	missense	probably damaging	1.00
R1641:Ttc3	UTSW	16	94443317	missense	probably benign	0.19
R2232:Ttc3	UTSW	16	94459972	missense	probably benign	0.00
R2339:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R2342:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R2842:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R3117:Ttc3	UTSW	16	94442563	missense	possibly damaging	0.51
R4194:Ttc3	UTSW	16	94422277	missense	probably damaging	0.99
R4329:Ttc3	UTSW	16	94466961	missense	probably damaging	1.00
R4431:Ttc3	UTSW	16	94410958	critical splice donor site	probably null
R4530:Ttc3	UTSW	16	94466877	intron	probably benign
R4531:Ttc3	UTSW	16	94466877	intron	probably benign
R4532:Ttc3	UTSW	16	94466877	intron	probably benign
R4533:Ttc3	UTSW	16	94466877	intron	probably benign
R4588:Ttc3	UTSW	16	94442901	missense	probably benign	0.01
R4625:Ttc3	UTSW	16	94388272	nonsense	probably null
R4676:Ttc3	UTSW	16	94442761	missense	probably damaging	1.00
R4700:Ttc3	UTSW	16	94439241	splice site	probably null
R4856:Ttc3	UTSW	16	94390283	missense	probably benign	0.32
R4867:Ttc3	UTSW	16	94454515	missense	probably damaging	0.96
R4885:Ttc3	UTSW	16	94419465	missense	probably damaging	1.00
R4885:Ttc3	UTSW	16	94426831	critical splice donor site	probably null
R4899:Ttc3	UTSW	16	94429455	missense	probably damaging	1.00
R4997:Ttc3	UTSW	16	94452982	missense	probably damaging	1.00
R5023:Ttc3	UTSW	16	94429359	missense	probably benign	0.01
R5105:Ttc3	UTSW	16	94466934	missense	possibly damaging	0.94
R5205:Ttc3	UTSW	16	94448059	missense	probably benign	0.07
R5287:Ttc3	UTSW	16	94459844	missense	probably benign	0.00
R5338:Ttc3	UTSW	16	94384041	missense	probably damaging	0.99
R5347:Ttc3	UTSW	16	94429620	missense	probably damaging	1.00
R5403:Ttc3	UTSW	16	94459844	missense	probably benign	0.00
R5460:Ttc3	UTSW	16	94457382	missense	probably benign	0.32
R5739:Ttc3	UTSW	16	94439324	nonsense	probably null
R6242:Ttc3	UTSW	16	94442695	missense	probably benign	0.04
R6253:Ttc3	UTSW	16	94457413	critical splice donor site	probably null
R6455:Ttc3	UTSW	16	94418623	start codon destroyed	probably null	0.83
R6559:Ttc3	UTSW	16	94422349	critical splice donor site	probably null
R6564:Ttc3	UTSW	16	94442611	missense	probably damaging	1.00
R6932:Ttc3	UTSW	16	94443453	missense	probably benign
R7331:Ttc3	UTSW	16	94394359	missense	probably benign	0.27
R7497:Ttc3	UTSW	16	94418682	missense	possibly damaging	0.93
R7610:Ttc3	UTSW	16	94427838	missense	probably benign	0.11
R7738:Ttc3	UTSW	16	94387382	missense	probably benign	0.00
R7970:Ttc3	UTSW	16	94457364	missense	probably damaging	1.00
R8052:Ttc3	UTSW	16	94467989	missense	probably benign	0.09
R8087:Ttc3	UTSW	16	94442953	missense	probably benign	0.00
R8309:Ttc3	UTSW	16	94466979	missense	probably damaging	1.00
R8320:Ttc3	UTSW	16	94418676	missense	probably damaging	1.00
R8322:Ttc3	UTSW	16	94454492	missense	probably damaging	1.00
R8518:Ttc3	UTSW	16	94457379	missense	probably benign	0.21
R8670:Ttc3	UTSW	16	94390208	missense	probably damaging	0.99
R8826:Ttc3	UTSW	16	94431970	missense	possibly damaging	0.85
R8868:Ttc3	UTSW	16	94451143	missense	probably benign	0.00
R8873:Ttc3	UTSW	16	94442983	missense	probably damaging	0.97
R8940:Ttc3	UTSW	16	94429499	missense	possibly damaging	0.94
R8993:Ttc3	UTSW	16	94427808	missense	possibly damaging	0.85
R9068:Ttc3	UTSW	16	94403360	missense	probably damaging	1.00
R9119:Ttc3	UTSW	16	94392091	missense	probably damaging	0.98
R9124:Ttc3	UTSW	16	94435530	missense	probably benign	0.00
R9129:Ttc3	UTSW	16	94384349	missense	probably benign	0.02
R9189:Ttc3	UTSW	16	94467972	missense	possibly damaging	0.62
R9217:Ttc3	UTSW	16	94429608	missense	possibly damaging	0.80
X0022:Ttc3	UTSW	16	94442525	missense	probably benign	0.00
Y5378:Ttc3	UTSW	16	94412129	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TCGACAACTGCATTGCATTG -3'
(R):5'- AGTGTGATTGAGCCCAGTATG -3'

Sequencing Primer
(F):5'- AAAAGTTGCCTCAAGACTCAAG -3'
(R):5'- AGCCCAGTATGTTGGTTTGGC -3'

Posted On

2014-09-18