Incidental Mutation 'R2092:Nfkbie'
ID 231880
Institutional Source Beutler Lab
Gene Symbol Nfkbie
Ensembl Gene ENSMUSG00000023947
Gene Name nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, epsilon
Synonyms
MMRRC Submission 040097-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock # R2092 (G1)
Quality Score 184
Status Not validated
Chromosome 17
Chromosomal Location 45555716-45563169 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45558539 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 140 (F140S)
Ref Sequence ENSEMBL: ENSMUSP00000024742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024742]
AlphaFold O54910
Predicted Effect probably benign
Transcript: ENSMUST00000024742
AA Change: F140S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000024742
Gene: ENSMUSG00000023947
AA Change: F140S

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
ANK 122 152 1.14e2 SMART
ANK 157 187 2.15e0 SMART
ANK 190 219 6.81e-3 SMART
ANK 233 262 5.09e-2 SMART
ANK 267 296 1.12e-3 SMART
ANK 300 329 1e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to components of NF-kappa-B, trapping the complex in the cytoplasm and preventing it from activating genes in the nucleus. Phosphorylation of the encoded protein targets it for destruction by the ubiquitin pathway, which activates NF-kappa-B by making it available to translocate to the nucleus. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,674,937 C1321* probably null Het
Abca8b A G 11: 109,966,708 F673L possibly damaging Het
Adam19 T G 11: 46,060,904 probably null Het
AI987944 T C 7: 41,374,617 T313A possibly damaging Het
Akap13 A T 7: 75,610,570 I178F probably benign Het
Alb G GA 5: 90,463,983 probably null Het
Bod1l A G 5: 41,831,517 S416P probably damaging Het
Casr A T 16: 36,510,043 Y310N possibly damaging Het
Cela3a T C 4: 137,404,426 N152S probably benign Het
Chrdl2 T A 7: 100,020,977 C102* probably null Het
Col4a4 G A 1: 82,498,946 S554L unknown Het
Col6a4 T C 9: 106,060,331 K1392R probably damaging Het
Dab1 T G 4: 104,678,777 Y128D probably damaging Het
Dars A T 1: 128,374,018 M293K probably damaging Het
Dlec1 T C 9: 119,121,844 F493L possibly damaging Het
Dmbt1 G T 7: 131,050,018 W330L probably damaging Het
Dnah11 A T 12: 118,012,716 M831K possibly damaging Het
Dock7 T C 4: 99,009,308 N715S possibly damaging Het
Edc4 T A 8: 105,887,528 L12Q probably damaging Het
Edem2 T C 2: 155,709,049 M333V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fto C A 8: 91,409,687 Y194* probably null Het
Gnptab T G 10: 88,440,305 Y1151* probably null Het
Grm1 A G 10: 10,689,225 L1113P probably benign Het
Hnrnpa0 T C 13: 58,127,800 K172E probably damaging Het
Ifitm1 A G 7: 140,969,514 D70G probably damaging Het
Irx4 C A 13: 73,265,486 T25K probably damaging Het
Kif22 C T 7: 127,033,630 D195N probably damaging Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Lyz1 C T 10: 117,288,599 R144Q probably benign Het
Macf1 T A 4: 123,383,178 T6055S probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myh9 G A 15: 77,764,350 Q80* probably null Het
Myo6 G T 9: 80,245,682 R199L probably damaging Het
Naglu G A 11: 101,076,720 V499I possibly damaging Het
Olfr1208 A G 2: 88,897,267 F110S probably damaging Het
Olfr1454 T A 19: 13,063,802 Y130* probably null Het
Olfr510 CAAATA CA 7: 108,667,662 probably null Het
Olfr598 G A 7: 103,329,109 V208M probably damaging Het
Olfr67 A T 7: 103,788,072 F68L possibly damaging Het
Olfr935 A T 9: 38,995,189 L82Q probably damaging Het
Otop1 A T 5: 38,299,766 I290F probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Pcdhb10 T A 18: 37,414,187 I772N probably benign Het
Pnliprp1 A G 19: 58,741,184 H423R probably benign Het
Ptk2 A T 15: 73,236,191 Y56* probably null Het
Rapgef3 T C 15: 97,760,723 D134G probably damaging Het
Scaf11 A C 15: 96,415,827 S1358A probably damaging Het
Scn9a T C 2: 66,533,376 M844V probably damaging Het
Sh3tc1 T C 5: 35,700,658 E1121G probably damaging Het
Slc25a15 T C 8: 22,380,934 T176A probably damaging Het
Slc29a4 T A 5: 142,718,855 I384N probably damaging Het
Slc40a1 A T 1: 45,909,454 D555E probably benign Het
Smc5 T C 19: 23,238,899 I446V probably benign Het
St6gal2 T C 17: 55,510,266 Y477H probably damaging Het
Syngr1 A T 15: 80,115,940 Q84L possibly damaging Het
Tedc1 T C 12: 113,157,720 L187P probably damaging Het
Tg A G 15: 66,849,607 I322V probably null Het
Thap12 T C 7: 98,716,449 V608A possibly damaging Het
Tmbim6 T C 15: 99,402,068 S22P probably damaging Het
Ttc3 C T 16: 94,442,832 P1232S probably benign Het
Upk3a A G 15: 85,018,085 T38A probably damaging Het
Utrn A T 10: 12,678,698 M1549K probably benign Het
Vmn1r176 C T 7: 23,835,153 D192N probably damaging Het
Vmn1r198 A G 13: 22,354,715 T35A possibly damaging Het
Xkr7 C T 2: 153,054,063 S279L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp641 G T 15: 98,293,712 T31N probably benign Het
Zfp74 G A 7: 29,953,924 probably benign Het
Other mutations in Nfkbie
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Nfkbie APN 17 45560213 critical splice donor site probably null
IGL01331:Nfkbie APN 17 45558569 missense probably benign 0.41
IGL01787:Nfkbie APN 17 45556263 missense probably damaging 1.00
IGL02162:Nfkbie APN 17 45556316 critical splice donor site probably null
R4289:Nfkbie UTSW 17 45558590 missense probably damaging 1.00
R4512:Nfkbie UTSW 17 45556239 missense probably benign 0.00
R4609:Nfkbie UTSW 17 45558584 missense probably damaging 1.00
R4720:Nfkbie UTSW 17 45556306 missense probably benign 0.19
R5420:Nfkbie UTSW 17 45560206 missense probably benign 0.01
R7226:Nfkbie UTSW 17 45559227 missense possibly damaging 0.85
R7304:Nfkbie UTSW 17 45560141 missense possibly damaging 0.95
R7472:Nfkbie UTSW 17 45559307 missense probably damaging 0.97
R8326:Nfkbie UTSW 17 45559308 missense probably damaging 1.00
R8915:Nfkbie UTSW 17 45560141 missense probably benign 0.01
R9038:Nfkbie UTSW 17 45559257 missense probably damaging 0.99
R9045:Nfkbie UTSW 17 45562033 missense probably damaging 1.00
Z1177:Nfkbie UTSW 17 45560508 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCCATCTCCAGAATCCTG -3'
(R):5'- GACGCTGCTTCCTCTGTATG -3'

Sequencing Primer
(F):5'- AGAATCCTGGCTTCCTGTATCAAC -3'
(R):5'- CTGTATGCATCTTTGTATTGCAGC -3'
Posted On 2014-09-18