Incidental Mutation 'R2093:Drc3'
ID231925
Institutional Source Beutler Lab
Gene Symbol Drc3
Ensembl Gene ENSMUSG00000056598
Gene Namedynein regulatory complex subunit 3
Synonyms4930449E07Rik, Lrrc48, m6Bei
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2093 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60353329-60394341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60370484 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 154 (R154W)
Ref Sequence ENSEMBL: ENSMUSP00000104363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070805] [ENSMUST00000094140] [ENSMUST00000108722] [ENSMUST00000108723]
Predicted Effect probably damaging
Transcript: ENSMUST00000070805
AA Change: R154W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065525
Gene: ENSMUSG00000056598
AA Change: R154W

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094140
AA Change: R154W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091691
Gene: ENSMUSG00000056598
AA Change: R154W

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108722
AA Change: R154W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104362
Gene: ENSMUSG00000056598
AA Change: R154W

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108723
AA Change: R154W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104363
Gene: ENSMUSG00000056598
AA Change: R154W

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128905
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
AA986860 A G 1: 130,743,304 D421G probably benign Het
Adamts1 T G 16: 85,802,445 Q89P probably benign Het
Arhgef10l T G 4: 140,570,290 N277T possibly damaging Het
Atp2c1 G A 9: 105,418,121 R669* probably null Het
Brip1 T C 11: 86,139,145 T558A possibly damaging Het
Cbr2 G A 11: 120,730,429 T148I probably benign Het
Ccdc110 C A 8: 45,942,077 T335K probably damaging Het
Cd44 T G 2: 102,814,284 D731A probably damaging Het
Cnot1 T C 8: 95,775,358 D44G probably damaging Het
Cnrip1 T C 11: 17,052,237 V23A probably damaging Het
Cntnap5c A T 17: 58,199,000 H673L probably benign Het
Col3a1 C T 1: 45,332,990 A493V probably damaging Het
Crem A T 18: 3,299,256 V19E probably damaging Het
Cyp2g1 A G 7: 26,819,433 D418G probably benign Het
Dmrta1 A T 4: 89,691,505 H234L probably benign Het
Eef1d A G 15: 75,902,701 S370P probably benign Het
Fdx1l T C 9: 21,073,424 H28R probably benign Het
Fmo5 A G 3: 97,645,878 I381V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fras1 T C 5: 96,781,203 L3822P probably damaging Het
Gm13212 C A 4: 145,622,569 T192N probably benign Het
Gm3604 G T 13: 62,369,606 H313N possibly damaging Het
Heatr4 T C 12: 83,975,081 E460G possibly damaging Het
Ino80 T A 2: 119,426,670 H834L possibly damaging Het
Insr A T 8: 3,204,762 C331S probably damaging Het
Itih4 C T 14: 30,891,737 L304F probably damaging Het
Klhdc3 C T 17: 46,677,953 V104I probably benign Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Map1b T C 13: 99,429,670 E2181G unknown Het
Map2 T C 1: 66,399,440 V41A probably damaging Het
Mical3 A T 6: 121,040,386 H156Q probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myo5b T A 18: 74,759,192 L1669Q probably damaging Het
Nme8 G A 13: 19,650,872 S548F probably damaging Het
Npas1 A T 7: 16,459,277 N408K probably benign Het
Olfr1076 A C 2: 86,509,243 Q261H probably damaging Het
Olfr339 A T 2: 36,421,929 Y177F probably benign Het
Pcnx4 T C 12: 72,579,442 Y1141H probably damaging Het
Pmaip1 C A 18: 66,460,981 P64Q probably damaging Het
Prrxl1 C T 14: 32,647,155 probably benign Het
Ranbp3 T A 17: 56,710,145 M387K probably damaging Het
Rbm4 A G 19: 4,787,764 Y231H probably damaging Het
Rpgrip1l T C 8: 91,270,132 S105G possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rtn3 A T 19: 7,456,850 D573E probably damaging Het
Rxrg T C 1: 167,627,324 C159R probably damaging Het
Sdk2 T C 11: 113,943,122 Y78C probably damaging Het
Smu1 A G 4: 40,738,438 V432A probably benign Het
Spag1 T C 15: 36,224,130 L609P probably damaging Het
Spata21 T G 4: 141,096,966 V180G probably benign Het
Sptlc3 A T 2: 139,625,874 I451F possibly damaging Het
Srl A G 16: 4,523,032 C8R unknown Het
Tmprss13 A G 9: 45,345,042 R485G probably damaging Het
Trpv4 C T 5: 114,635,504 A266T probably damaging Het
Vmn1r198 A G 13: 22,354,685 T25A probably benign Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Vmn2r82 C T 10: 79,395,979 T604I probably benign Het
Zfp354a C T 11: 51,069,724 T254I probably damaging Het
Other mutations in Drc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Drc3 APN 11 60364962 missense probably null 0.70
IGL01457:Drc3 APN 11 60358649 utr 5 prime probably benign
IGL02329:Drc3 APN 11 60370578 missense probably damaging 1.00
IGL02576:Drc3 APN 11 60370551 missense probably benign 0.01
IGL02610:Drc3 APN 11 60370593 missense probably benign 0.40
IGL02817:Drc3 APN 11 60384236 missense probably benign 0.16
IGL03380:Drc3 APN 11 60377905 missense probably benign 0.01
R0020:Drc3 UTSW 11 60370545 missense probably damaging 1.00
R1221:Drc3 UTSW 11 60384226 missense probably benign
R1394:Drc3 UTSW 11 60393719 missense possibly damaging 0.94
R1483:Drc3 UTSW 11 60388889 missense probably benign 0.00
R2151:Drc3 UTSW 11 60375157 missense probably benign 0.15
R4631:Drc3 UTSW 11 60364908 missense probably benign 0.02
R4796:Drc3 UTSW 11 60363528 missense probably damaging 1.00
R4841:Drc3 UTSW 11 60370535 missense probably benign 0.00
R4842:Drc3 UTSW 11 60370535 missense probably benign 0.00
R5739:Drc3 UTSW 11 60375130 missense possibly damaging 0.89
R5766:Drc3 UTSW 11 60393821 missense probably benign 0.18
R6143:Drc3 UTSW 11 60370580 missense possibly damaging 0.82
R6298:Drc3 UTSW 11 60393770 missense possibly damaging 0.74
R6558:Drc3 UTSW 11 60364892 missense probably damaging 1.00
R6611:Drc3 UTSW 11 60364947 missense probably damaging 0.99
R6938:Drc3 UTSW 11 60394123 critical splice acceptor site probably null
R7013:Drc3 UTSW 11 60387303 missense probably benign 0.00
R7108:Drc3 UTSW 11 60370554 missense probably benign 0.13
R7640:Drc3 UTSW 11 60388904 missense probably benign
R7713:Drc3 UTSW 11 60370560 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACTCTCAGGATTGAAGTCTGTCTC -3'
(R):5'- GCTCAGCCAGGAAAACATGC -3'

Sequencing Primer
(F):5'- CAGGATTGAAGTCTGTCTCAGAACTC -3'
(R):5'- GAGAGCGTCTCACTGTCTCATGAC -3'
Posted On2014-09-18