Incidental Mutation 'R2093:Brip1'
ID231926
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2093 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86139145 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 558 (T558A)
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044423
AA Change: T558A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: T558A

DomainStartEndE-ValueType
DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
AA986860 A G 1: 130,743,304 D421G probably benign Het
Adamts1 T G 16: 85,802,445 Q89P probably benign Het
Arhgef10l T G 4: 140,570,290 N277T possibly damaging Het
Atp2c1 G A 9: 105,418,121 R669* probably null Het
Cbr2 G A 11: 120,730,429 T148I probably benign Het
Ccdc110 C A 8: 45,942,077 T335K probably damaging Het
Cd44 T G 2: 102,814,284 D731A probably damaging Het
Cnot1 T C 8: 95,775,358 D44G probably damaging Het
Cnrip1 T C 11: 17,052,237 V23A probably damaging Het
Cntnap5c A T 17: 58,199,000 H673L probably benign Het
Col3a1 C T 1: 45,332,990 A493V probably damaging Het
Crem A T 18: 3,299,256 V19E probably damaging Het
Cyp2g1 A G 7: 26,819,433 D418G probably benign Het
Dmrta1 A T 4: 89,691,505 H234L probably benign Het
Drc3 C T 11: 60,370,484 R154W probably damaging Het
Eef1d A G 15: 75,902,701 S370P probably benign Het
Fdx1l T C 9: 21,073,424 H28R probably benign Het
Fmo5 A G 3: 97,645,878 I381V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fras1 T C 5: 96,781,203 L3822P probably damaging Het
Gm13212 C A 4: 145,622,569 T192N probably benign Het
Gm3604 G T 13: 62,369,606 H313N possibly damaging Het
Heatr4 T C 12: 83,975,081 E460G possibly damaging Het
Ino80 T A 2: 119,426,670 H834L possibly damaging Het
Insr A T 8: 3,204,762 C331S probably damaging Het
Itih4 C T 14: 30,891,737 L304F probably damaging Het
Klhdc3 C T 17: 46,677,953 V104I probably benign Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Map1b T C 13: 99,429,670 E2181G unknown Het
Map2 T C 1: 66,399,440 V41A probably damaging Het
Mical3 A T 6: 121,040,386 H156Q probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myo5b T A 18: 74,759,192 L1669Q probably damaging Het
Nme8 G A 13: 19,650,872 S548F probably damaging Het
Npas1 A T 7: 16,459,277 N408K probably benign Het
Olfr1076 A C 2: 86,509,243 Q261H probably damaging Het
Olfr339 A T 2: 36,421,929 Y177F probably benign Het
Pcnx4 T C 12: 72,579,442 Y1141H probably damaging Het
Pmaip1 C A 18: 66,460,981 P64Q probably damaging Het
Prrxl1 C T 14: 32,647,155 probably benign Het
Ranbp3 T A 17: 56,710,145 M387K probably damaging Het
Rbm4 A G 19: 4,787,764 Y231H probably damaging Het
Rpgrip1l T C 8: 91,270,132 S105G possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rtn3 A T 19: 7,456,850 D573E probably damaging Het
Rxrg T C 1: 167,627,324 C159R probably damaging Het
Sdk2 T C 11: 113,943,122 Y78C probably damaging Het
Smu1 A G 4: 40,738,438 V432A probably benign Het
Spag1 T C 15: 36,224,130 L609P probably damaging Het
Spata21 T G 4: 141,096,966 V180G probably benign Het
Sptlc3 A T 2: 139,625,874 I451F possibly damaging Het
Srl A G 16: 4,523,032 C8R unknown Het
Tmprss13 A G 9: 45,345,042 R485G probably damaging Het
Trpv4 C T 5: 114,635,504 A266T probably damaging Het
Vmn1r198 A G 13: 22,354,685 T25A probably benign Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Vmn2r82 C T 10: 79,395,979 T604I probably benign Het
Zfp354a C T 11: 51,069,724 T254I probably damaging Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1885:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3421:Brip1 UTSW 11 86152669 nonsense probably null
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4384:Brip1 UTSW 11 86148429 missense possibly damaging 0.70
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4518:Brip1 UTSW 11 86077878 missense possibly damaging 0.92
R4522:Brip1 UTSW 11 86189801 missense possibly damaging 0.49
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5176:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R5525:Brip1 UTSW 11 86110447 missense possibly damaging 0.85
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
R7053:Brip1 UTSW 11 86192965 missense possibly damaging 0.53
R7235:Brip1 UTSW 11 86138875 missense possibly damaging 0.53
R7253:Brip1 UTSW 11 86143278 missense possibly damaging 0.96
R7347:Brip1 UTSW 11 86139103 missense probably benign 0.34
R7476:Brip1 UTSW 11 86157808 missense probably benign 0.33
R7580:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R7771:Brip1 UTSW 11 86062024 missense probably benign 0.02
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TATCTGAAAAGGCCTGCAAGG -3'
(R):5'- CCTGAGTTAACTAGTGATGGGG -3'

Sequencing Primer
(F):5'- ATTTCTGGTCCTAGTCAAGACAAG -3'
(R):5'- TGGGGACAGCATTTTCTTCTG -3'
Posted On2014-09-18