Incidental Mutation 'R0193:Ngef'
ID23193
Institutional Source Beutler Lab
Gene Symbol Ngef
Ensembl Gene ENSMUSG00000026259
Gene Nameneuronal guanine nucleotide exchange factor
SynonymsTims2, ephexin
MMRRC Submission 038452-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0193 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location87476834-87573870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87509334 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 144 (L144P)
Ref Sequence ENSEMBL: ENSMUSP00000066894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027477] [ENSMUST00000068681] [ENSMUST00000166055]
Predicted Effect probably benign
Transcript: ENSMUST00000027477
AA Change: L54P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027477
Gene: ENSMUSG00000026259
AA Change: L54P

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 15 28 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
RhoGEF 187 366 8.16e-46 SMART
PH 400 513 1.2e-7 SMART
SH3 525 582 8.43e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068681
AA Change: L144P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066894
Gene: ENSMUSG00000026259
AA Change: L144P

DomainStartEndE-ValueType
low complexity region 213 226 N/A INTRINSIC
RhoGEF 277 456 8.16e-46 SMART
PH 490 603 1.2e-7 SMART
SH3 615 672 8.43e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166055
SMART Domains Protein: ENSMUSP00000132099
Gene: ENSMUSG00000079434

DomainStartEndE-ValueType
Pfam:BNR_2 32 110 8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168856
Meta Mutation Damage Score 0.3679 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no overt axonal phenotype; however, cultured retinal ganglion cells display defects in axonal outgrowth and ephrin-induced growth cone collapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,422,359 Q352L probably damaging Het
Adgrb1 T C 15: 74,572,156 S96P probably damaging Het
Akr1c20 A G 13: 4,511,293 probably benign Het
Atp2a3 G T 11: 72,972,220 V99L possibly damaging Het
Atp6v0a1 T A 11: 101,048,482 I691N possibly damaging Het
Atp8b1 C T 18: 64,561,636 R525Q probably benign Het
Aurkb A G 11: 69,048,544 D151G probably damaging Het
Bank1 A T 3: 136,066,518 probably benign Het
Bcl9l T C 9: 44,507,406 L847P probably damaging Het
Bscl2 T A 19: 8,847,429 M292K probably benign Het
Cacna1c C T 6: 118,602,402 probably benign Het
Cadps2 T C 6: 23,599,440 K260R probably benign Het
Cc2d2a T C 5: 43,736,118 S1419P probably damaging Het
Ccdc180 G A 4: 45,914,803 E145K probably benign Het
Ccdc58 T C 16: 36,082,814 S59P probably damaging Het
Ccno C T 13: 112,988,884 probably benign Het
Cd300a A G 11: 114,893,376 D70G probably benign Het
Cenpc1 T C 5: 86,032,403 D670G probably benign Het
Cenpl A G 1: 161,085,988 I323V probably damaging Het
Cfap44 A G 16: 44,449,210 probably null Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clcnkb T C 4: 141,412,316 E125G possibly damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Coro7 G A 16: 4,627,504 probably benign Het
Dchs1 C T 7: 105,764,983 R875H probably benign Het
Eif3j1 A C 2: 122,052,027 M239L probably benign Het
Eif4g3 G T 4: 138,146,376 probably benign Het
Erbb4 T C 1: 68,043,960 probably benign Het
Erlin2 T G 8: 27,031,764 V164G possibly damaging Het
Fbxo43 G T 15: 36,161,883 Q393K probably benign Het
Fcgr4 A T 1: 171,025,760 N178I possibly damaging Het
Grid2 A G 6: 64,063,953 N293S possibly damaging Het
H2-M1 C T 17: 36,671,332 V126I probably benign Het
Htr1f T A 16: 64,926,749 Y60F probably damaging Het
Ilf2 A G 3: 90,481,339 probably null Het
Impg2 A T 16: 56,265,049 K931* probably null Het
Ints1 T C 5: 139,751,730 E2176G probably damaging Het
Iqsec2 T C X: 152,223,403 V1319A probably benign Het
Iqsec3 G T 6: 121,410,724 D685E probably damaging Het
Itgbl1 G A 14: 123,846,546 V279I probably benign Het
Kdm4b C T 17: 56,393,952 A541V probably benign Het
Kif14 A T 1: 136,468,438 T161S probably benign Het
Krt86 T C 15: 101,479,363 probably benign Het
Kyat1 C T 2: 30,187,186 probably null Het
Limch1 T C 5: 67,027,539 W791R probably damaging Het
Map3k11 T A 19: 5,695,846 M396K probably damaging Het
Mat2a A G 6: 72,436,195 probably null Het
Mbnl2 A G 14: 120,379,237 I88V possibly damaging Het
Mib2 T C 4: 155,655,673 T708A probably benign Het
Mkks T C 2: 136,877,606 probably null Het
Mtss1 T C 15: 58,944,017 M565V probably damaging Het
Myoc A G 1: 162,649,035 N436S probably damaging Het
Myod1 T A 7: 46,377,112 V147E probably damaging Het
Ngrn C T 7: 80,261,930 R92W probably damaging Het
Nup153 G A 13: 46,709,654 T349I probably benign Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr600 G T 7: 103,346,204 S241R possibly damaging Het
Pigl A G 11: 62,503,748 I135M probably damaging Het
Pitpnm3 A G 11: 72,070,492 probably benign Het
Pkhd1 A T 1: 20,358,917 F2420I probably damaging Het
Polr2b C T 5: 77,320,076 T119M probably damaging Het
Prr29 A G 11: 106,376,896 Y130C probably damaging Het
Rab11fip3 T C 17: 25,990,999 I1048V probably damaging Het
Rab12 G A 17: 66,500,362 T124I probably damaging Het
Rab44 A G 17: 29,140,307 S490G probably benign Het
Rasa3 A G 8: 13,570,233 probably null Het
Rhbdl3 C T 11: 80,353,574 S369L possibly damaging Het
Rimbp2 A T 5: 128,788,356 S643T probably benign Het
Rin1 T G 19: 5,052,652 S396R probably damaging Het
Rpusd3 C T 6: 113,419,237 G28S probably damaging Het
Rtl9 T A X: 143,100,278 S229T probably damaging Het
Rufy1 G T 11: 50,389,852 T701N probably benign Het
Scn4a A T 11: 106,320,538 L1551* probably null Het
Sec24b T C 3: 129,988,984 N1119S probably null Het
Serbp1 T A 6: 67,272,884 *75R probably null Het
Setx C T 2: 29,179,673 P2497S probably benign Het
Slc26a11 A T 11: 119,359,314 I132F probably damaging Het
Slc4a1 A G 11: 102,352,684 V707A possibly damaging Het
Slfn1 A G 11: 83,121,843 I262V probably damaging Het
Tmem168 T A 6: 13,583,313 D523V possibly damaging Het
Traf7 G T 17: 24,510,551 Q469K probably benign Het
Trdmt1 C A 2: 13,544,617 V6F probably damaging Het
Tsacc A T 3: 88,287,088 probably benign Het
Vmn2r5 A G 3: 64,491,530 I589T possibly damaging Het
Vmn2r7 T C 3: 64,691,039 D699G probably damaging Het
Vmn2r82 T C 10: 79,381,295 V487A probably damaging Het
Zfp287 A T 11: 62,715,029 S351T probably benign Het
Zfp651 T C 9: 121,767,666 V696A probably damaging Het
Zfp654 T C 16: 64,785,688 H176R possibly damaging Het
Other mutations in Ngef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02221:Ngef APN 1 87540696 missense probably benign 0.06
IGL02475:Ngef APN 1 87479150 missense possibly damaging 0.79
IGL02478:Ngef APN 1 87480579 splice site probably benign
IGL03002:Ngef APN 1 87509392 splice site probably null
H8562:Ngef UTSW 1 87487807 missense possibly damaging 0.84
R0078:Ngef UTSW 1 87540665 missense probably benign 0.12
R0145:Ngef UTSW 1 87540648 intron probably benign
R0244:Ngef UTSW 1 87487962 unclassified probably benign
R0486:Ngef UTSW 1 87479126 missense probably damaging 1.00
R0865:Ngef UTSW 1 87484601 missense probably benign
R1824:Ngef UTSW 1 87503264 critical splice donor site probably null
R1994:Ngef UTSW 1 87487904 missense probably damaging 1.00
R2020:Ngef UTSW 1 87545968 missense probably benign 0.43
R4059:Ngef UTSW 1 87486231 missense probably damaging 0.99
R4770:Ngef UTSW 1 87477561 missense probably damaging 1.00
R4959:Ngef UTSW 1 87503348 missense possibly damaging 0.68
R5197:Ngef UTSW 1 87509368 nonsense probably null
R5286:Ngef UTSW 1 87545830 missense probably benign
R5293:Ngef UTSW 1 87503429 small deletion probably benign
R6065:Ngef UTSW 1 87477648 missense probably damaging 1.00
R6192:Ngef UTSW 1 87487900 missense probably damaging 0.98
R6925:Ngef UTSW 1 87503263 splice site probably null
R7176:Ngef UTSW 1 87480695 missense possibly damaging 0.94
R7437:Ngef UTSW 1 87480605 missense probably damaging 0.98
R7760:Ngef UTSW 1 87540773 missense probably benign 0.00
R8058:Ngef UTSW 1 87546022 nonsense probably null
R8142:Ngef UTSW 1 87540741 missense probably benign
R8154:Ngef UTSW 1 87540760 missense probably benign
R8697:Ngef UTSW 1 87489737 missense probably damaging 0.99
R8769:Ngef UTSW 1 87481161 missense probably damaging 1.00
R8784:Ngef UTSW 1 87477571 missense probably damaging 1.00
R8790:Ngef UTSW 1 87477597 missense probably benign 0.10
R8907:Ngef UTSW 1 87477654 missense probably damaging 1.00
Z1177:Ngef UTSW 1 87482709 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTGCAGCACTAATAAAACTCGGCAG -3'
(R):5'- ACTGGTGTAGGAGTGAATCACCCC -3'

Sequencing Primer
(F):5'- GCACTAATAAAACTCGGCAGTTCTG -3'
(R):5'- CCCTTGGCTTGGAAGCTC -3'
Posted On2013-04-16