Incidental Mutation 'R2093:Gm3604'
ID231934
Institutional Source Beutler Lab
Gene Symbol Gm3604
Ensembl Gene ENSMUSG00000094942
Gene Namepredicted gene 3604
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R2093 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location62368328-62383177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62369606 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 313 (H313N)
Ref Sequence ENSEMBL: ENSMUSP00000139845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107989] [ENSMUST00000187656] [ENSMUST00000202194]
Predicted Effect probably benign
Transcript: ENSMUST00000107989
AA Change: H312N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103623
Gene: ENSMUSG00000094942
AA Change: H312N

DomainStartEndE-ValueType
KRAB 3 65 4.49e-17 SMART
ZnF_C2H2 132 154 2.71e-2 SMART
ZnF_C2H2 160 182 1.3e-4 SMART
ZnF_C2H2 188 210 5.21e-4 SMART
ZnF_C2H2 216 238 1.82e-3 SMART
ZnF_C2H2 244 266 7.78e-3 SMART
ZnF_C2H2 272 294 3.69e-4 SMART
ZnF_C2H2 300 322 3.95e-4 SMART
ZnF_C2H2 328 350 9.08e-4 SMART
ZnF_C2H2 356 378 1.45e-2 SMART
ZnF_C2H2 384 406 1.92e-2 SMART
ZnF_C2H2 412 434 1.3e-4 SMART
ZnF_C2H2 440 462 4.87e-4 SMART
ZnF_C2H2 468 490 1.4e-4 SMART
ZnF_C2H2 496 518 3.95e-4 SMART
ZnF_C2H2 524 546 2.29e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187656
AA Change: H313N

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139845
Gene: ENSMUSG00000094942
AA Change: H313N

DomainStartEndE-ValueType
KRAB 4 66 1.9e-19 SMART
ZnF_C2H2 133 155 1.2e-4 SMART
ZnF_C2H2 161 183 5.5e-7 SMART
ZnF_C2H2 189 211 2.3e-6 SMART
ZnF_C2H2 217 239 7.5e-6 SMART
ZnF_C2H2 245 267 3.4e-5 SMART
ZnF_C2H2 273 295 1.5e-6 SMART
ZnF_C2H2 301 323 1.7e-6 SMART
ZnF_C2H2 329 351 3.7e-6 SMART
ZnF_C2H2 357 379 6.3e-5 SMART
ZnF_C2H2 385 407 7.8e-5 SMART
ZnF_C2H2 413 435 5.5e-7 SMART
ZnF_C2H2 441 463 2e-6 SMART
ZnF_C2H2 469 491 5.8e-7 SMART
ZnF_C2H2 497 519 1.6e-6 SMART
ZnF_C2H2 525 547 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202194
SMART Domains Protein: ENSMUSP00000144048
Gene: ENSMUSG00000094942

DomainStartEndE-ValueType
KRAB 4 65 1.2e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
AA986860 A G 1: 130,743,304 D421G probably benign Het
Adamts1 T G 16: 85,802,445 Q89P probably benign Het
Arhgef10l T G 4: 140,570,290 N277T possibly damaging Het
Atp2c1 G A 9: 105,418,121 R669* probably null Het
Brip1 T C 11: 86,139,145 T558A possibly damaging Het
Cbr2 G A 11: 120,730,429 T148I probably benign Het
Ccdc110 C A 8: 45,942,077 T335K probably damaging Het
Cd44 T G 2: 102,814,284 D731A probably damaging Het
Cnot1 T C 8: 95,775,358 D44G probably damaging Het
Cnrip1 T C 11: 17,052,237 V23A probably damaging Het
Cntnap5c A T 17: 58,199,000 H673L probably benign Het
Col3a1 C T 1: 45,332,990 A493V probably damaging Het
Crem A T 18: 3,299,256 V19E probably damaging Het
Cyp2g1 A G 7: 26,819,433 D418G probably benign Het
Dmrta1 A T 4: 89,691,505 H234L probably benign Het
Drc3 C T 11: 60,370,484 R154W probably damaging Het
Eef1d A G 15: 75,902,701 S370P probably benign Het
Fdx1l T C 9: 21,073,424 H28R probably benign Het
Fmo5 A G 3: 97,645,878 I381V probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fras1 T C 5: 96,781,203 L3822P probably damaging Het
Gm13212 C A 4: 145,622,569 T192N probably benign Het
Heatr4 T C 12: 83,975,081 E460G possibly damaging Het
Ino80 T A 2: 119,426,670 H834L possibly damaging Het
Insr A T 8: 3,204,762 C331S probably damaging Het
Itih4 C T 14: 30,891,737 L304F probably damaging Het
Klhdc3 C T 17: 46,677,953 V104I probably benign Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Map1b T C 13: 99,429,670 E2181G unknown Het
Map2 T C 1: 66,399,440 V41A probably damaging Het
Mical3 A T 6: 121,040,386 H156Q probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myo5b T A 18: 74,759,192 L1669Q probably damaging Het
Nme8 G A 13: 19,650,872 S548F probably damaging Het
Npas1 A T 7: 16,459,277 N408K probably benign Het
Olfr1076 A C 2: 86,509,243 Q261H probably damaging Het
Olfr339 A T 2: 36,421,929 Y177F probably benign Het
Pcnx4 T C 12: 72,579,442 Y1141H probably damaging Het
Pmaip1 C A 18: 66,460,981 P64Q probably damaging Het
Prrxl1 C T 14: 32,647,155 probably benign Het
Ranbp3 T A 17: 56,710,145 M387K probably damaging Het
Rbm4 A G 19: 4,787,764 Y231H probably damaging Het
Rpgrip1l T C 8: 91,270,132 S105G possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rtn3 A T 19: 7,456,850 D573E probably damaging Het
Rxrg T C 1: 167,627,324 C159R probably damaging Het
Sdk2 T C 11: 113,943,122 Y78C probably damaging Het
Smu1 A G 4: 40,738,438 V432A probably benign Het
Spag1 T C 15: 36,224,130 L609P probably damaging Het
Spata21 T G 4: 141,096,966 V180G probably benign Het
Sptlc3 A T 2: 139,625,874 I451F possibly damaging Het
Srl A G 16: 4,523,032 C8R unknown Het
Tmprss13 A G 9: 45,345,042 R485G probably damaging Het
Trpv4 C T 5: 114,635,504 A266T probably damaging Het
Vmn1r198 A G 13: 22,354,685 T25A probably benign Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Vmn2r82 C T 10: 79,395,979 T604I probably benign Het
Zfp354a C T 11: 51,069,724 T254I probably damaging Het
Other mutations in Gm3604
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Gm3604 APN 13 62370140 missense probably damaging 1.00
IGL02601:Gm3604 APN 13 62370176 missense possibly damaging 0.79
IGL03386:Gm3604 APN 13 62370167 missense possibly damaging 0.95
R1539:Gm3604 UTSW 13 62371600 missense possibly damaging 0.70
R1771:Gm3604 UTSW 13 62370074 nonsense probably null
R1776:Gm3604 UTSW 13 62370074 nonsense probably null
R1919:Gm3604 UTSW 13 62369942 missense probably benign 0.02
R1954:Gm3604 UTSW 13 62369211 missense probably damaging 0.97
R2291:Gm3604 UTSW 13 62371843 missense probably damaging 0.99
R2909:Gm3604 UTSW 13 62369018 missense probably benign 0.43
R3195:Gm3604 UTSW 13 62370054 nonsense probably null
R3196:Gm3604 UTSW 13 62370054 nonsense probably null
R3924:Gm3604 UTSW 13 62370230 missense probably damaging 0.99
R4328:Gm3604 UTSW 13 62369265 missense possibly damaging 0.88
R4543:Gm3604 UTSW 13 62370156 missense probably benign
R4830:Gm3604 UTSW 13 62369043 missense probably damaging 0.98
R5129:Gm3604 UTSW 13 62369774 missense probably benign 0.00
R5496:Gm3604 UTSW 13 62371579 missense possibly damaging 0.85
R6184:Gm3604 UTSW 13 62371845 missense probably damaging 1.00
R6426:Gm3604 UTSW 13 62369622 missense probably damaging 1.00
R6925:Gm3604 UTSW 13 62369390 missense probably benign 0.16
R7080:Gm3604 UTSW 13 62370295 missense probably damaging 1.00
R7182:Gm3604 UTSW 13 62371875 missense probably damaging 0.99
R7572:Gm3604 UTSW 13 62370246 missense probably damaging 1.00
R7750:Gm3604 UTSW 13 62369996 missense possibly damaging 0.92
R8023:Gm3604 UTSW 13 62369869 missense probably damaging 1.00
R8062:Gm3604 UTSW 13 62370341 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAGTATGTGTTCTTCTATGAGTTT -3'
(R):5'- ACACATACCGGAGAGAAACCTT -3'

Sequencing Primer
(F):5'- ACATTTGTAGGGTTTCTCTCCAG -3'
(R):5'- GTGATAAAGCCTTTTCCCAATACAG -3'
Posted On2014-09-18