Incidental Mutation 'R2093:Fpr-rs4'
ID231943
Institutional Source Beutler Lab
Gene Symbol Fpr-rs4
Ensembl Gene ENSMUSG00000048062
Gene Nameformyl peptide receptor, related sequence 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2093 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location18021733-18022704 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGGAA to CA at 18022334 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095651]
Predicted Effect probably null
Transcript: ENSMUST00000095651
SMART Domains Protein: ENSMUSP00000093311
Gene: ENSMUSG00000048062

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 4.9e-35 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
AA986860 A G 1: 130,743,304 D421G probably benign Het
Adamts1 T G 16: 85,802,445 Q89P probably benign Het
Arhgef10l T G 4: 140,570,290 N277T possibly damaging Het
Atp2c1 G A 9: 105,418,121 R669* probably null Het
Brip1 T C 11: 86,139,145 T558A possibly damaging Het
Cbr2 G A 11: 120,730,429 T148I probably benign Het
Ccdc110 C A 8: 45,942,077 T335K probably damaging Het
Cd44 T G 2: 102,814,284 D731A probably damaging Het
Cnot1 T C 8: 95,775,358 D44G probably damaging Het
Cnrip1 T C 11: 17,052,237 V23A probably damaging Het
Cntnap5c A T 17: 58,199,000 H673L probably benign Het
Col3a1 C T 1: 45,332,990 A493V probably damaging Het
Crem A T 18: 3,299,256 V19E probably damaging Het
Cyp2g1 A G 7: 26,819,433 D418G probably benign Het
Dmrta1 A T 4: 89,691,505 H234L probably benign Het
Drc3 C T 11: 60,370,484 R154W probably damaging Het
Eef1d A G 15: 75,902,701 S370P probably benign Het
Fdx1l T C 9: 21,073,424 H28R probably benign Het
Fmo5 A G 3: 97,645,878 I381V probably benign Het
Fras1 T C 5: 96,781,203 L3822P probably damaging Het
Gm13212 C A 4: 145,622,569 T192N probably benign Het
Gm3604 G T 13: 62,369,606 H313N possibly damaging Het
Heatr4 T C 12: 83,975,081 E460G possibly damaging Het
Ino80 T A 2: 119,426,670 H834L possibly damaging Het
Insr A T 8: 3,204,762 C331S probably damaging Het
Itih4 C T 14: 30,891,737 L304F probably damaging Het
Klhdc3 C T 17: 46,677,953 V104I probably benign Het
Lrp2 C T 2: 69,536,021 D245N probably benign Het
Map1b T C 13: 99,429,670 E2181G unknown Het
Map2 T C 1: 66,399,440 V41A probably damaging Het
Mical3 A T 6: 121,040,386 H156Q probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Myo5b T A 18: 74,759,192 L1669Q probably damaging Het
Nme8 G A 13: 19,650,872 S548F probably damaging Het
Npas1 A T 7: 16,459,277 N408K probably benign Het
Olfr1076 A C 2: 86,509,243 Q261H probably damaging Het
Olfr339 A T 2: 36,421,929 Y177F probably benign Het
Pcnx4 T C 12: 72,579,442 Y1141H probably damaging Het
Pmaip1 C A 18: 66,460,981 P64Q probably damaging Het
Prrxl1 C T 14: 32,647,155 probably benign Het
Ranbp3 T A 17: 56,710,145 M387K probably damaging Het
Rbm4 A G 19: 4,787,764 Y231H probably damaging Het
Rpgrip1l T C 8: 91,270,132 S105G possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Rtn3 A T 19: 7,456,850 D573E probably damaging Het
Rxrg T C 1: 167,627,324 C159R probably damaging Het
Sdk2 T C 11: 113,943,122 Y78C probably damaging Het
Smu1 A G 4: 40,738,438 V432A probably benign Het
Spag1 T C 15: 36,224,130 L609P probably damaging Het
Spata21 T G 4: 141,096,966 V180G probably benign Het
Sptlc3 A T 2: 139,625,874 I451F possibly damaging Het
Srl A G 16: 4,523,032 C8R unknown Het
Tmprss13 A G 9: 45,345,042 R485G probably damaging Het
Trpv4 C T 5: 114,635,504 A266T probably damaging Het
Vmn1r198 A G 13: 22,354,685 T25A probably benign Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Vmn2r82 C T 10: 79,395,979 T604I probably benign Het
Zfp354a C T 11: 51,069,724 T254I probably damaging Het
Other mutations in Fpr-rs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fpr-rs4 APN 17 18021926 missense probably damaging 1.00
IGL01064:Fpr-rs4 APN 17 18022517 missense probably damaging 1.00
IGL01626:Fpr-rs4 APN 17 18022231 missense probably damaging 0.97
IGL02544:Fpr-rs4 APN 17 18022211 missense probably benign
IGL02837:Fpr-rs4 UTSW 17 18022251 missense probably benign 0.00
R0179:Fpr-rs4 UTSW 17 18022027 nonsense probably null
R0383:Fpr-rs4 UTSW 17 18022097 missense probably damaging 1.00
R0686:Fpr-rs4 UTSW 17 18022351 missense probably benign 0.05
R1551:Fpr-rs4 UTSW 17 18022327 missense possibly damaging 0.89
R1956:Fpr-rs4 UTSW 17 18022256 missense probably damaging 0.97
R2040:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2041:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2043:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2045:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2048:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2092:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2136:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R3624:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R4684:Fpr-rs4 UTSW 17 18022184 missense probably damaging 1.00
R6076:Fpr-rs4 UTSW 17 18022055 missense probably damaging 1.00
R6247:Fpr-rs4 UTSW 17 18022486 missense probably benign 0.00
R6639:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R6757:Fpr-rs4 UTSW 17 18022132 nonsense probably null
Z1088:Fpr-rs4 UTSW 17 18021919 missense possibly damaging 0.85
Z1088:Fpr-rs4 UTSW 17 18022694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGCCAGAAAAGTGGTTCTTG -3'
(R):5'- CCAAGGTATTTGCTGGGTTAACC -3'

Sequencing Primer
(F):5'- CCAGAAAAGTGGTTCTTGGAGCTTG -3'
(R):5'- GCTCAGTGTCTCATTGTTAAAGATG -3'
Posted On2014-09-18